VHDL: Is there a convenient way to assign ascii values to std_logic
0. In your example you are trying to assign a string type to a std_logic_vector type. That is simply not allowed. VHDL is strongly typed. SIGNAL hello : OUT std_logic_vector (39 DOWNTO 0); ... hello <= "hello"; If your goal is to convert from hexa to ascii for printing simulation result you can simply do that:
How to easily resize strings in VHDL?
In VHDL, strings are no more than arrays, the very same way std_logic_vectors are arrays. You should think about assign strings the same way you do when assigning (part of) logic arrays. Here in your example code, you seem to want to assign a variable-length string literal to a (constrained) string variable.
String Functions in VHDL
This VHDL code defines a set of string manipulation functions similar to those available in higher-level languages. We've implemented functions for checking if a string contains a substring, counting occurrences of a character, checking for prefixes and suffixes, finding the index of a substring, joining strings, repeating strings, and converting to lower and uppercase.
PDF VHDL Handbook
- string literal (a sequence of graphical characters surrounded by ", e.g.: "HAR-DI") - *bit string literal (a sequence of extended digits surrounded by ", e.g.: "011") - comment (preceded by -- and is valid until the end of the line) Character set The character set in VHDL'87 is 128 characters, in VHDL'93 it is 256
Using string type in VHDL
1) String variable/signal must be given bounds when it is created. Unlike C++ it does not seem to internally expand/contract to fit what is assigned to it at run-time. This should be possible for an aggregate. 2) Cannot use (others=>'') notation with string type even though it is supposed to be an array. 3) Sometimes I have a string returned ...
VHDL MINI-REFERENCE
VHDL IDENTIFIERS, NUMBERS, STRINGS, AND EXPRESSIONS - Back To Top Identifiers Identifiers in VHDL must begin with a letter, and may comprise any combination of letters, digits, and underscores. ... Assign a waveform to one signal driver (edit the event queue). Example A <= B after 10ns; C <= A after 10ns; -- value of C is current A value ...
fpga
The VHDL-2008 standard defines in chapter 5.2.2 enumeration types and says this: Each enumeration literal yields a different enumeration value. The predefined order relations between enumeration values follow the order of corresponding position numbers. The position number of the value of the first listed enumeration literal is zero; the ...
An Introduction to VHDL Data Types
The code snippet below gives some examples of how we assign data to vector types in VHDL.-- Assigning a value of 11b to a std_logic_vector example <= "11"; -- Assigning a hex value to a std_logic_vector example <= x"aa"; When we are working with the VHDL-2008 standard we can also assign vector data using an octal number. This works in the same ...
How to create a list of strings in VHDL
end procedure; Step number two is to translate the index argument to an index that conforms to the list's range. Python's list.insert () implementation allows out-of-bounds indexes, and our VHDL list will allow it too. If the user references a too high or low index, it will default to the highest index, or element 0.
[SOLVED]
String in VHDL is declared as a character array. Thus, in my case I have declared a string that can contain the largest string assigned to it in a select case construct: So I have: variable instr_str : string (1 to 4); and then assigning value to it in case statement. case instr(5 downto 0) is when alu_add => instr_str := "add"; when alu_sub =>
Padding strings
Hello folks, thought I could save the effort of writing a function to pad strings. Rarely a good idea. Because subprograms offer dynamic elaboration, they make this kind of thing MUCH easier. by using 'Others =>' in a concatenation assignment as follows. My_String <= Signal_Name'Simple_Name & (Others => ' '); But the OTHERS is not related to ...
vhdl
17. ok, what I would like to do is assign a smaller std_vector to a large one, padding out the upper bits with zeros. But, I want something generic and simple that doesn't involve knowing the size of each first. for instance if I have: signal smaller_vec: std_logic_vector(15 downto 0); signal larger_vec: std_logic_vector(31 downto 0); I could do:
VHDL Example Code of Concatenation Operator
For example you cannot concatenate three std_logic signals together into a six bit wide std_logic_vector signal. The VHDL concatenation operator must always be to the right of the assignment operator (<= or :=). So in the example below, first you need to concatenate the values r_VAL_1 and r_VAL_2 into a variable prior to the case statement.
VHDL-2008: Easier to use
VHDL-2008 makes the generate statement much more flexible. It is now allowed to use else and elsif. Also there is a case version of generate. This makes generate easier to use. Instead of writing. g1: if mode = 0 generate. c1 : entity work.comp(rtl1) port map (a => a, b => b); end generate;
VHDL: setting a constant conditionally based on another constant's
end entity; architecture rtl of bridge is. constant fifo_aw_wdata :natural := 2 + burst_mode * 3; begin. If the datatype of burst_mode cannot be changed, then you can also do it with a type conversion: library ieee; use ieee.std_logic_1164.all; use ieee.numeric_std.all; entity bridge is.
How to bring out internal signals of a lower module to a top module in
This feature was added in VHDL-2008 so it should be supported by all tools that already have VHDL-2008 support (including ActiveHDL I think). Most simulators do not use VHDL-2008 by default but provide a command line argument or configuration option to enable it.
Automatically constrain string size using initialization in VHDL
I'm working with VHDL, and I'm wondering if there is any way to constrain the string size when declaring it, using initialization. For example, we declare a string as follow: variable sequence : string(1 to 20) := "AGTAACCAATTCGCATTCGC"; I would like to know if there is any way to do something like:
VHDL: How to assign value to an input?
begin. sel <= "00"; wait for 1 us; sel <= "01"; -- and so on. end process; end simple; For synthesis, if you simply wanted to implement the MUX in your FPGA, you can synthesise it as-is. Then there is one additional step before you can place and route it to generate a bitfile to program the FPGA.
IMAGES
VIDEO
COMMENTS
0. In your example you are trying to assign a string type to a std_logic_vector type. That is simply not allowed. VHDL is strongly typed. SIGNAL hello : OUT std_logic_vector (39 DOWNTO 0); ... hello <= "hello"; If your goal is to convert from hexa to ascii for printing simulation result you can simply do that:
In VHDL, strings are no more than arrays, the very same way std_logic_vectors are arrays. You should think about assign strings the same way you do when assigning (part of) logic arrays. Here in your example code, you seem to want to assign a variable-length string literal to a (constrained) string variable.
This VHDL code defines a set of string manipulation functions similar to those available in higher-level languages. We've implemented functions for checking if a string contains a substring, counting occurrences of a character, checking for prefixes and suffixes, finding the index of a substring, joining strings, repeating strings, and converting to lower and uppercase.
- string literal (a sequence of graphical characters surrounded by ", e.g.: "HAR-DI") - *bit string literal (a sequence of extended digits surrounded by ", e.g.: "011") - comment (preceded by -- and is valid until the end of the line) Character set The character set in VHDL'87 is 128 characters, in VHDL'93 it is 256
1) String variable/signal must be given bounds when it is created. Unlike C++ it does not seem to internally expand/contract to fit what is assigned to it at run-time. This should be possible for an aggregate. 2) Cannot use (others=>'') notation with string type even though it is supposed to be an array. 3) Sometimes I have a string returned ...
VHDL IDENTIFIERS, NUMBERS, STRINGS, AND EXPRESSIONS - Back To Top Identifiers Identifiers in VHDL must begin with a letter, and may comprise any combination of letters, digits, and underscores. ... Assign a waveform to one signal driver (edit the event queue). Example A <= B after 10ns; C <= A after 10ns; -- value of C is current A value ...
The VHDL-2008 standard defines in chapter 5.2.2 enumeration types and says this: Each enumeration literal yields a different enumeration value. The predefined order relations between enumeration values follow the order of corresponding position numbers. The position number of the value of the first listed enumeration literal is zero; the ...
The code snippet below gives some examples of how we assign data to vector types in VHDL.-- Assigning a value of 11b to a std_logic_vector example <= "11"; -- Assigning a hex value to a std_logic_vector example <= x"aa"; When we are working with the VHDL-2008 standard we can also assign vector data using an octal number. This works in the same ...
end procedure; Step number two is to translate the index argument to an index that conforms to the list's range. Python's list.insert () implementation allows out-of-bounds indexes, and our VHDL list will allow it too. If the user references a too high or low index, it will default to the highest index, or element 0.
String in VHDL is declared as a character array. Thus, in my case I have declared a string that can contain the largest string assigned to it in a select case construct: So I have: variable instr_str : string (1 to 4); and then assigning value to it in case statement. case instr(5 downto 0) is when alu_add => instr_str := "add"; when alu_sub =>
Hello folks, thought I could save the effort of writing a function to pad strings. Rarely a good idea. Because subprograms offer dynamic elaboration, they make this kind of thing MUCH easier. by using 'Others =>' in a concatenation assignment as follows. My_String <= Signal_Name'Simple_Name & (Others => ' '); But the OTHERS is not related to ...
17. ok, what I would like to do is assign a smaller std_vector to a large one, padding out the upper bits with zeros. But, I want something generic and simple that doesn't involve knowing the size of each first. for instance if I have: signal smaller_vec: std_logic_vector(15 downto 0); signal larger_vec: std_logic_vector(31 downto 0); I could do:
For example you cannot concatenate three std_logic signals together into a six bit wide std_logic_vector signal. The VHDL concatenation operator must always be to the right of the assignment operator (<= or :=). So in the example below, first you need to concatenate the values r_VAL_1 and r_VAL_2 into a variable prior to the case statement.
VHDL-2008 makes the generate statement much more flexible. It is now allowed to use else and elsif. Also there is a case version of generate. This makes generate easier to use. Instead of writing. g1: if mode = 0 generate. c1 : entity work.comp(rtl1) port map (a => a, b => b); end generate;
end entity; architecture rtl of bridge is. constant fifo_aw_wdata :natural := 2 + burst_mode * 3; begin. If the datatype of burst_mode cannot be changed, then you can also do it with a type conversion: library ieee; use ieee.std_logic_1164.all; use ieee.numeric_std.all; entity bridge is.
This feature was added in VHDL-2008 so it should be supported by all tools that already have VHDL-2008 support (including ActiveHDL I think). Most simulators do not use VHDL-2008 by default but provide a command line argument or configuration option to enable it.
I'm working with VHDL, and I'm wondering if there is any way to constrain the string size when declaring it, using initialization. For example, we declare a string as follow: variable sequence : string(1 to 20) := "AGTAACCAATTCGCATTCGC"; I would like to know if there is any way to do something like:
begin. sel <= "00"; wait for 1 us; sel <= "01"; -- and so on. end process; end simple; For synthesis, if you simply wanted to implement the MUX in your FPGA, you can synthesise it as-is. Then there is one additional step before you can place and route it to generate a bitfile to program the FPGA.