fluoride in drinking water research paper

Fluoride in Drinking Water and Skeletal Fluorosis: a Review of the Global Impact

Affiliations.

• 1 National Institute of Pharmaceutical Education and Research, Near CRPF Base Camp, Bijnor-Sisendi Road, Post Office Mati, Lucknow, U.P., 226 002, India.
• 2 National Institute of Pharmaceutical Education and Research, Near CRPF Base Camp, Bijnor-Sisendi Road, Post Office Mati, Lucknow, U.P., 226 002, India. [email protected].
• PMID: 32207100
• DOI: 10.1007/s40572-020-00270-9

When safe and adequate exposure of an essential trace element is exceeded it becomes potentially toxic. Fluoride is one classic example of such a double edged sword which both plays a fundamental role in the normal growth and development of the body for example the consumption of levels between 0.5-1.0 ppm via drinking water is beneficial for prevention of dental caries but its excessive consumption leads to development of fluorosis. PURPOSE OF REVIEW: The abundance of fluorine in the environment as well as in drinking water sources are the major contributors to fluorosis. It is a serious public health concern as it is a noteworthy medical problem in 24 nations including India yet the threat of fluorosis has not been rooted out. The review focuses on recent findings related to skeletal fluorosis and role of oxidative stress in its development. The fluoride mitigation strategies adopted in recent years are also discussed. RECENT FINDINGS BASED ON CASE STUDIES: Recent findings revealed that consumption of fluoride at concentrations of 1.5 ppm is majorly responsible for skeletal fluorosis. The sampling from rural areas showed that 80% villages are having fluoride concentrations more than the WHO permissible limits and people residing in such areas are affected by the skeletal fluorosis and also in the regions of Africa and Asia endemic fluorosis have been accounted in the majority of the region affecting approximately 100 million people. Various mitigation programmes and strategies have been conducted all over the world using defluoridation. Fluorosis is a slow and progressive malady affecting our body and a serious concern to be taken into consideration and to be dealt with effectively. The fluoride toxicity although reversible, is a slow process and the side effects lack treatment options. The treatment options available are either not approachable or affordable in the rural areas commonly suffering from the fluoride toxicity. No specific treatments are available to date to treat skeletal fluorosis affectively; therefore, prevention is one of most safest and best approach to fight fluorosis. The current review lays emphasis on the skeletal fluorosis and its prevalence in recent years. It also includes the recent findings as well as the current strategies related to combat skeletal fluorosis and provides findings that might be helpful to promote the research in the field of effective treatment for fluorosis as well as development of easy and affordable methods of fluoride removal from water.

Keywords: Defluoridation; Drinking water; Fluorosis; Mitigation; Skeletal fluorosis; Treatment.

Publication types

• Cariostatic Agents / analysis
• Cariostatic Agents / toxicity*
• Drinking Water / chemistry*
• Fluorides / analysis
• Fluorides / toxicity*
• Fluorosis, Dental / epidemiology*
• Global Burden of Disease / trends*
• India / epidemiology
• Cariostatic Agents
• Drinking Water

Is Fluoridated Drinking Water Safe?

Countries that do not fluoridate their water have also seen big drops in the rate of cavities..

Since the mid-1940s, compounds containing the mineral fluoride have been added to community water supplies throughout the U.S. to prevent tooth decay. Health concerns expressed by opponents have largely been dismissed until recently. Now, evidence is mounting that in an era of fluoridated toothpastes and other consumer products that boost dental health, the potential risks from consuming fluoridated water may outweigh the benefits for some individuals. Last summer, for the first time in 53 years, the U.S. Public Health Service lowered its recommended levels of fluoride in drinking water.

The Evidence

Beginning in the early 20th century, scientists linked high levels of naturally occurring fluoride in certain community water supplies to low levels of tooth decay. In 1945, Grand Rapids, Michigan, became the first community in the world to add fluoride to tap water. When subsequent studies showed a significantly lower rate of cavities in schoolchildren, water fluoridation spread to other towns and cities. U.S. Centers for Disease Control and Prevention named community water fluoridation one of the 10 great public health achievements of the 20th century.

But many experts now question the scientific basis for the intervention. In June 2015, the Cochrane Collaboration—a global independent network of researchers and health care professionals known for rigorous scientific reviews of public health policies—published an analysis of 20 key studies on water fluoridation.  They found that while water fluoridation is effective at reducing tooth decay among children, “no studies that aimed to determine the effectiveness of water fluoridation for preventing caries [cavities] in adults met the review’s inclusion criteria.”  *

The Cochrane report also concluded that early scientific investigations on water fluoridation (most were conducted before 1975) were deeply flawed. “We had concerns about the methods used, or the reporting of the results, in … 97 percent of the studies,” the authors noted. One problem: The early studies didn’t take into account the subsequent widespread use of fluoride-containing toothpastes and other dental fluoride supplements, which also prevent cavities. This may explain why countries that do not fluoridate their water have also seen big drops in cavity rates (see chart).

Source: OECD.Stat/Dental Health

Chart updated on June 15, 2016. An earlier version of this chart incorrectly listed Australia and Chile as having non-fluoridated water. The water in both countries is fluoridated.

Moreover, fluoride itself may be dangerous at high levels. Excessive fluoride causes fluorosis—changes in tooth enamel that range from barely noticeable white spots to staining and pitting. Fluoride can also become concentrated in bone—stimulating bone cell growth, altering the tissue’s structure, and weakening the skeleton.

Perhaps most worrisome is preliminary research in laboratory animals suggesting that high levels of fluoride may be toxic to brain and nerve cells. And human epidemiological studies have identified possible links to learning, memory, and cognition deficits, though most of these studies have focused on populations with fluoride exposures higher than those typically provided by U.S. water supplies.

The Bottom Line

Comments by Philippe Grandjean, adjunct professor of environmental health, Harvard T.H. Chan School of Public Health:

“We should recognize that fluoride has beneficial effects on dental development and protection against cavities. But do we need to add it to drinking water so it gets into the bloodstream and potentially into the brain? To answer this, we must establish three research priorities.

“First, since dental cavities have decreased in countries both with and without water fluoridation, we need to make sure we are dosing our water with the proper amount of fluoride for dental medicine purposes, but no more.

“Second, we need to make sure fluoridation doesn’t raise the risk of adverse health effects. In particular, we need basic research on animals that would help us understand the mechanisms by which fluoride may be toxic to the developing brain.

“Third, we need to find out if there are populations highly vulnerable to fluoride in drinking water—bottle-fed infants whose formula is made with tap water, for example, or patients undergoing dialysis. If these individuals are at risk, their water must come from a source that is lower in fluoride.”

* This description of the Cochrane Collaboration’s findings in relation to water fluoridation and adult cavities is a clarification of the text in the print edition of the Spring 2016 Harvard Public Health , where this article originally appeared.

Nicole Davis is a science writer and communications consultant specializing in biomedicine and biotechnology. She holds a PhD in genetics from Harvard University.

News from the School

At Convocation, Harvard Chan School graduates urged to meet climate and public health crises with fresh thinking, collective action

Graduation 2024: Award winners

Once a malaria patient, student now has sights set on stopping the deadly disease

Providing compassionate care to marginalized people

Fluoride contamination, consequences and removal techniques in water: a review †

First published on 28th September 2022

Fluoride contamination has created a drinking water crisis globally. At low concentrations, its presence is essential; however, it becomes toxic to human beings upon consumption of more than 1.5 mg L −1 in mainly contaminated drinking water due to geochemical reactions and geological or anthropogenic factors. To better understand the toxicity of fluoride, in this study, we examine the recent research on the possible negative consequences of excess fluoride on diverse species. A high fluoride concentration in drinking water cause skeletal fluorosis and long-term kidney, brain, thyroid, and liver damages. This review also focuses on the different techniques for the defluoridation of water, such as electro-coagulation, adsorption, membrane processes, etc. , and compares their adsorption capabilities under various situations, while their changes in the literature are reviewed. Furthermore, we present the advantages and disadvantages of different methods and conclude that each technique has shortcomings, with no single approach fitting all aspects. The condition of water pollution with fluoride and recently created technology to remove fluoride from water is evaluated, although research on fluoride contamination of water resources has been reviewed in the literature. Alternatively, this study also examines fluorosis mitigation strategies in the global and Indian settings and existing physicochemical and biological mitigation approaches. Also, the research and development results in fluoride clean-up are reviewed. Specifically, the following topics will be covered in this review: (1) fluoride contamination status, (2) consequences of fluoride contamination in drinking water on human health, and (3) current defluoridation technology.

1. Introduction

Some rocks such as fluorite, biotite, topaz, fluorapatite, cryolite hornblende, and muscovite contain fluoride-rich minerals, which release fluoride present in them after interacting with water. 5 The fluoride ion concentration available in groundwater is dependent on various factors, which include the physio-chemical condition of the aquifer from where the groundwater is extracted, 6 intensity of rock weathering, depth of water in the aquifer, 7 acidity and porosity of soil and rocks, interaction between different chemical elements, temperature in the surrounding region, 8 mineral composition of rocks, and the geochemistry of the groundwater. 9 In arid and semi-arid regions, the concentration of fluoride in the groundwater is maximum. However, most of the world's groundwater is observed to cross the fluoride concentration standard limit, as suggested by the WHO. 10 According to the WHO guideline, the concentration of fluoride in drinking water should be in the range of 0.5 to 1.5 mg L −1 , which is generally safe. 11 However, the amount may vary between 0.5 to 1.0 mg L −1 depending on climatic variables such as temperature. 12 Regarding the two climatic conditions, hot and cold climates, the maximum fluoride concentration suggested by the WHO is 1 and 1.5 mg L −1 , respectively, 13 which accounts for the higher water consumption in the hotter climate than in the colder weather. 14 The national standard limit that meets the maximum fluoride value in drinking water is reported to be 1.0 mg L −1 . If the fluoride level crosses the limit of 1.0 mg L −1 by any means, either anthropogenic or geogenic sources, the groundwater will be classified as fluoride-polluted groundwater. In our country, the practical limit for fluoride in drinking water is recognized to be 1 mg L −1 . However, the concentration range of fluoride in drinking water varies according to different organizations such as the WHO, Bureau of Indian Standards (BIS), Indian Standard Institution (ISI), Indian Council of Medical Research (ICMR), and others, as listed in Table S1. † It has been observed that a large portion of the population globally (mainly >200 million) depends on drinking water with a concentration of fluoride greater than the safe limit described by the WHO, which is 1.5 mg L −1 . Fish and tea contain a high fluoride content, and hence members of the population eating this food are more prone to fluoride exposure. 15

Consequently, studying the sustainability of excessive fluoride in groundwater and its hazardous impact on people is critical worldwide. Herein, we aim focus on the severity and seriousness of this issue by analyzing the current studies and presenting information on the exclusive and extraordinary Indian research on the effect of a higher natural concentration of fluoride in groundwater and the public scientifically. Furthermore, we aim to dissect the origins, bioavailability, and geochemistry of fluoride and its worldwide rank, focusing on human health consequences.

2. Fluorine: chemical profile

3. sources of fluoride, 3.1 paths of fluoride uptake, 4. contamination in ground water, 4.1 geogenic source.

Under average temperature and pressure conditions, hydrogen fluoride and sodium fluoride are sufficiently soluble, whereas calcium and magnesium fluoride are poorly soluble. The hydraulic conductivity of aquifers, groundwater circulation, and various other geochemical processes regulate the advancement of fluoride concentration in groundwater 76 and F − bearing minerals. 77 After a detailed study, it was found that the fluoride concentration also changes with a change in the groundwater level. The presence of clay also impacts the dissolution of fluoride in the groundwater because it can reduce the hydraulic conductivity and enhance the time of residence of water in aquifers. 78 Fluoride with a content of almost 295 ppm is also present in coal. 79 In humid areas, the fluoride level is less prominent because they receive massive rainfall, which finally dilutes the fluoride level to a great extent. Volcanic eruption also contributes fluoride to groundwater. Volcanic ash containing fluoride is released during volcanic eruptions, which occur during rainfall. Moreover, due to the high solubility of volcanic ash, it readily comes in contact with groundwater. Even after the completion of volcanic activity, the fluoride concentration remains high in the surrounding water and grass for many years. 80

4.2 Anthropogenic sources

5. health effects.

The primary basis of fresh water is groundwater, which is the most consumed form for irrigation purposes. According to the report presented by the WHO, more than 25 countries have a concentration of fluoride more than the permissible limit, and nearly 200 million people depend on the contaminated water, which is a severe threat causing health issues to consumers. Many African countries have a higher fluoride concentration than the guideline set by the WHO of 1.5 mg L −1 . 87 The Asian countries with a high fluoride concentration in their groundwater include Bangladesh, China, India, Indonesia, Iran, Iraq, Jordan, Korea, Pakistan, Palestine, Saudi Arabia, Sri Lanka, Syria, Thailand, Turkey, and Yemen. 88 The regions of Canada, Mexico, and the United States especially need defluoridation due to the high fluoride concentration in their groundwater. 89 Even countries of Latin America, namely Argentina, Ecuador, and Peru, have high fluoride concentrations in their groundwater. 90 A excessive concentration of fluoride in groundwater is a significant problem in European countries. Some regions of Germany also face this problem. 91 Fig. 3 displays a world map with all the countries having drinking water with fluoride. 92

In 1937, the Prakasam area of Andhra Pradesh reported the first incidence of fluorosis endemic in humans. 93 Only four states of India, namely Andhra Pradesh, Uttar Pradesh, Punjab, and Tamil Nadu, were recognized with fluorosis patients in 1950. Currently, fluoride is present in 20 of India's 29 states, which is projected to rise, 94 as shown in Fig. 4 . Fig. 4 displays a map of India with fluoride in the drinking water in all districts. 95 In India, just a few families with fluorosis were found in 1937. However, fluorosis was projected to affect 25 million individuals in India by the United Nations International Children's Emergency Fund (UNICEF) in 1995. Currently, fluorosis affects 66 million people in India, with 6 million children less than 14. Around 411 million individuals in 201 districts across 20 states are affected by fluoride in India, and thus are possibly in danger of fluoride poisoning.

5.2 Teeth and bones

In the three districts of Rajasthan, India, namely Dungarpur, Banswara, and Udaipur, a survey was conducted and it was reported that more than 21% of teenagers and 36% of adults of the area having fluoride concentration of 1.5 ppm in the drinking water were affected by dental fluorosis. Also, the fastest spreading rate (77.1%) of dental fluorosis was found in the age group of 17–22 years. 108 The other effects of fluorosis are restricted joint movement, joint pain, and limb motor dysfunction. In India and some other countries, these symptoms make life very complex for people suffering from severe health issues such as paralysis. 108

5.4 Reproductive

5.5 liver and kidney, 5.7 immune system, 5.8 skeletal, 5.9 developmental, 5.11 endocrine, 5.12 gastrointestinal, 5.13 carcinogenic, 5.14 hair and fingernails, 5.15 soft tissues, 5.16 cerebrospinal fluid, 5.18 faeces, 5.19 saliva, 5.20 perspiration, 5.21 breast milk, 5.22 cytotoxicity, 5.23 hypersensitivity, 5.25 genotoxicity, 5.26 other toxic effects, 6. fluoride mitigation knowledge.

Furthermore, in endemic parts of the developing world, adsorption/ion exchange and coagulation procedures are extensively utilized as fluoride removal strategies. Many nations, including India and Tanzania, utilize defluoridation treatments that are both residential and community-based at various levels. People in India and Sri Lanka have recently had a paradigm change in their attitudes about community-based water treatment schemes that use activated alumina as an electro-coagulation and sorbent. Moreover, most defluoridation methods are out of reach for people living in fluoride-affected rural regions. Other processes such as nanofiltration, electrodialysis, and reverse osmosis, can provide superior quality water, but they are costly and require a high level of technical expertise, limiting their application in fluoride removal. Fig. 5 presents a schematic diagram explaining the fundamental principles of several defluoridation procedures.

Each approach has its own set of benefits, drawbacks, and influencing variables, and it only works well under ideal circumstances. Various physical and chemical methods may accomplish defluoridation of drinkable water. Biological approaches for phytoremediation and defluoridation of the air, water, and soil employing bio-sorbents generated from plant materials and bioremediation via bacteria have also been documented.

6.1 Chemical and physical process of defluoridation

The fluoride ion replaces the chloride ion in the resin, and the substitution process continues until every site of the resin is occupied. To regenerate the resin, it is back-washed with water containing dissolved sodium chloride salt, enabling fluoride to be replaced by chloride and start acting as an ion exchanger. 190 The fluoride ion possesses higher electronegativity, which is the specific driving force to replace chloride ions in the resin. By using lanthanum, Chikuma et al. 191 modified the method of fluoride removal by anion exchange. Chikuma and Nishimura 192 used Amberlite IRA-400 in an aqueous solution for fluoride removal and found that the fluoride ion replaces the chloride ion present in the resin. Ho et al. 193 increased the capacity of the ion exchange method through titanium oxyhydroxide. Zirconia and silica having tiny particle sizes are doped on iron oxyhydroxide, a mesoporous material, to increase its ion exchange capacity, but this process is expensive and the issue of membrane arises. Meenakshi et al. 194 investigated the fluoride removal capacity of chelating Ceralite IRA 400 (CER) and Resin FR 10 (IND) and concluded that in comparison to the anion exchange resin, the chelating resin is highly selective for the removal of fluoride. The ion exchange technique has a high potential for eliminating fluoride from aqueous solutions (up to 95%). However, the resins are costly, making the treatment uneconomical although the resins may be readily renewed. Furthermore, the regeneration process generates a lot of fluoride-loaded waste, which is a downside of the technique. 195

The adsorption capacity, fluoride removal effectiveness under ideal experimental circumstances, and regeneration capacity of important adsorbents are summarised below.

The solution pH is responsible for the adsorption of fluoride on activated alumina due to the electrostatic interactions between the alumina surface and dominant species with fluoride in the solution.

Table 1 shows a comparison of several aluminum-based adsorbents for the removal of fluoride under ideal experimental circumstances. Based on physical factors that impact the complicated chemistry of fluoride in water, the performance of different adsorbents may vary.

Table 2 shows a comparison of several calcium-based adsorbents for fluoride removal under ideal experimental circumstances. Based on the physical factors that impacted the complicated chemistry of fluoride in water, the performance of different adsorbents may vary.

Table 3 shows a comparison of several oxide/hydroxide-based adsorbents for fluoride removal under ideal experimental circumstances. Based on the physical factors that impacting the complicated chemistry of fluoride in water, the performance of different adsorbents may vary.

Table 4 shows a comparison of several carbon-based adsorbents for fluoride removal under ideal experimental circumstances. Based on the physical factors that impact the complicated chemistry of fluoride inside water, the performance of different adsorbents may vary.

Table 5 shows a comparison of several natural-based adsorbents for the removal of fluoride under ideal experimental circumstances. Based on the physical factors impacting the complicated chemistry of fluoride in water, the performance of different adsorbents may vary.

Table 6 shows a comparison of several agricultural and biomass-based adsorbents for fluoride removal under ideal experimental circumstances. Based on the physical factors that impact the complicated chemistry of fluoride in water, the performance of different adsorbents may vary.

Table 7 shows a comparison of several building-based adsorbents for the removal of fluoride under ideal experimental circumstances. Based on the physical factors that impacted the complicated chemistry of fluoride in water, the performance of different adsorbents may vary.

Table 8 shows a comparison of several nanomaterial-based adsorbents for the removal of fluoride under the ideal experimental circumstances. Based on the physical factors that impact the complicated chemistry of fluoride in water, the performance of different adsorbents may vary.

The following sections examine the various strategies for removing F − , and Table 9 summarises the areas of interest and limitations of each methodology. The following observations were concluded regarding the different methodologies for fluoride removal based on the literature reviewed.

(1) A perusal of the above-mentioned table shows that adsorption gives favorable results in efficiency, technology, and cost, but the main issue is the dumping of the sludge generated in the process.

(2) The ion-exchange method removes fluoride very efficiently, but the treated water is found to have a high chloride residue, and this method is also expensive.

(3) The coagulation/precipitation technique has the limitation of fluoride removal of up to 33% and also produces a large quantity of residue, having an excess amount of residual aluminum.

(4) Reverse osmosis and nanofiltration techniques have higher efficiency for fluoride removal, but they are expensive and few essential ions are removed.

(5) The electrocoagulation technique is the most suitable for removing fluoride if the above-mentioned issues are considered, but the continuous supply of power required is one of its drawbacks.

(6) In the last few years, the adsorption technique for the removal of fluoride has attracted significant attention due to the very high adsorption power shown by some of the adsorbents, but the main issue is to choose an appropriate adsorbent because commonly, a particular adsorbent gives excellent adsorption in the laboratory but simultaneously fails in the field.

(7) Lastly, it should be noted that every technique has limitations, and hence a single technique is not suitable for all countries because different countries have different concentrations of fluoride and other ions present in their groundwater.

A broad overview of the available technologies for fluoride removal and the advantages and limitations of each one were presented based on a literature survey and the experiments conducted in the laboratory with several processes. It has been concluded that the selection of the treatment process should be site-specific according to the local needs and prevailing conditions given that each technology has some limitations and no one process can serve this purpose in diverse conditions.

6.2 Defluoridation through biological mediators

Fungi are more suitable for defluoridation than bacteria because they have shorter multiplication cycles and more natural growing procedures. Fungal biomass has a high proportion of cell-wall components, which increase its surface area and diversity of functional groups, supporting its biosorption capacity. 415 The fungal classes with defluoridation possibly comprise Pleurotus ostreatus 1804. 416

Defluoridation potential has also been boosted by the waste produced and processed from agricultural items such as fruits and crops. 417 Agricultural leftovers have unique chemical compositions including lipids and hemicellulose and are cost-effective and ecologically friendly. Some functional groups in these polymers promote F-binding through biosorption. 405

Boukhris et al. 420 found that the fluoride accumulation in aerial native plants in the soil was more in coastal superphosphate factories, which was in the range of 37 and 360 mg kg −1 . Spirodela polyrhiza was shown to remove 12.71–19.87% F − from 3 mg F − L −1 polluted water by Karmakar et al. 421

6.3 Integrated methods

7. regeneration issue, 8. sustainable technologies for the removal of fluoride.

Fluoride-containing sludge is manufactured from municipal and industrial wastewater. Water fluoridation can lead to fluoride levels in the municipal wastewater treatment plant (MWTP), and it is observed that most fluoride is released from industrial wastewater. 425 The projection of wastewater discharge was estimated to be between 75–80% for the supplied water, which infers that the water obtained will accumulate in the wastewater treatment plant (WWTP). The above-mentioned process suggests that the fluoride level of the WWTP depends on the overall grade. The non-accumulated water is targeted as a section of run-off and pipe leaks that enter the environment without any full-fledged treatment. Later, the fluoride constrains the process of nitrification where the fluoride removal is not reported in the primary treatment phase. 426 The leading cause of this action is the availability of bacteria in the anaerobic digestion, which are very sensitive towards fluoride, resulting in about 50% reduced microbial metabolism. 426 Therefore, it can be inferred that the level of fluoride removal in persistent pollution in conventional municipal wastewater treatment plants (CMWTP) also leads to disadvantageous effects on WWTP efficacy.

The above-mentioned industrial procedures generate fluoride as wastewater effluents. Therefore, various technologies were formulated for removing fluoride and even for its reuse. It was found that the fertilizer industries used precipitation to remove fluoride in their effluents and recovered fluoride to obtain economic welfare. Sorbents were used for water containing fluoride. The absorbent and sludge-producing water treatment were responsible for synthesizing a high quantity of waste using landfill disposal. Another method for sludge disposal besides landfill is incineration, which is responsible for sterilizing and reducing the weight and volume, and later transforming sludge into ash, basically burning substances at 1000 °C. 427 The substantial leaching of sewage sludge ash varies given that it contains inert waste, namely fluoride. Therefore, it is observed that highly soluble fluoride-containing waste is not suitable for direct discharge in the sanitary landfill. The most convenient source to avoid fluoride leaching is pre-treating the waste through stabilization and solidification. This pre-treatment method for fluoride-containing water is usually employed in pesticide industry. 428

Hence, redirecting fluoride sludge to its recovery and reuse is emerging nowadays. Recusing calcium fluoride sludge (CFS) has garnered interest from researchers worldwide because of the harmful and pollution potential of fluoride and the sudden decline in landfill capacity. The possibility of replacing cement with CFS has also been considered. 429

The respective features represent that the development of fluoride treatment is based on its incineration and landfill disposal. However, it is observed that the recent methodologies do not guarantee absolute its confinement and reintroduce the contaminant in a different way in the environment, finally requiring further development. The contemporary methods are responsible for slowing the entry into the background again. The recovery of fluoride is still limited in practice and technical aspects, and thus investigations are an essential but continuous challenge towards sustainability. It has been found that the mechanism of disposal is not a sustaining aspect with the rapid growth of waste volume in developing countries.

Regulatory bodies play a significant role in defining the characteristics and parameters of fluoride. The fluoride regulation for drinking water varies from country to agency. However, it is the same regarding the standard for effluents and environmental levels. According to the consent of public health, there are varying perspectives on the level of fluoride based on human health, from non-nutrient to micronutrient and essential nutrients. 430 A literature survey revealed that regular investigations are carried out to overcome the negative effects and more researchers are interested in this area based on its valuable aspects. The use of fluoride-containing dentifrice shows minimum risk, whereas the use of municipal fluoridation is a severe threat, which requires policy making. Thus, an organized definition of fluoride is needed with perceptible objectives.

According to the analysis done in the literature, the shift in the linear economy (LE) and circular economy (CE) shows great potentials. As an efficient specification of sustainability development (SD), the CE is not capable of coping with economic stability and is included for environmental protection and social equity. 431 The economic benefits are the main reason for CE, highlighting the ecological and the beneficial social aspects, generating the momentum for the use of the CE. The maintenance of public health is recognized as an important node on the web. The use of fluoride may lead to hazardous health issues, creating public health problems that also impact macroeconomics. The environmental degradation arising because fluoride affects plants, animals, agriculture, aquaculture, and stocks shows economic and ecological connections. The protection method shows more expenditure efforts and has benefited the economy. Many scholars from the last few decades have already reported the poverty–environmental–deterioration relation, whose web linkage cannot be overestimated or neglected. 432 Environmental deterioration (ED) can be a problem for public health, affecting the poorer class and posing socio-economic and ecological impacts. Therefore, the deterioration in the lifestyle of people with health issues has deteriorated the unexploited labour quality in the entire country.

Finally, artificial municipal water fluoridation is a significant problem and is considered the critical node for the network of fluoride, showing enormous considerable aspects. The re-consumption of fluoride from industrial by-products helps adhere to the economic benefits. It is believed that municipal fluoridation is not capable of reflecting the principle of CE. Given that the fluoride is retrieved from a fluoride conduit, it finally ends up at the disposal area, making its reuse economically appealing. Water is the natural medium for transporting fluoride in various forms such as agriculture, food, and beverages.

The fluoridation technique may undergo social justice because of ethical problems and disregarding the poor. The method of artificial fluoridation is practiced for the unprivileged society without any access to dental care. However, a lack of understanding and knowledge can also avoid the primary objective of helping the poor. According to a literature study, the fate of fluoride in humans and its severe effect leads to disease. The resource governance is working to develop advanced resource flows and involves comprehensive aspects in a diverse range. 433 Following the CE, it is recommended to shift from artificial fluoridation towards other fluoride applications.

Technological development plays a significant role in improving the recovery of fluoride and emerges as a challenging aspect for the disposal of fluoride. Multiple applications must pose inclusive, deliberate, and aligned principles. Thus, the decision-making body needs to create a strong and mutual linkage to attain this task.

Therefore, the critical problem of developing sustainable defluoridation technologies confronts the global scientific assets for a long duration.

9. Preventive procedures

9.1 awareness, 9.2 substitute water source, 9.3 moving the dietary behaviors, 10. fluorosis mitigation programmes, 10.1 worldwide scenario.

A device with taps and a cotton cloth put on the sieve to which alum and lime were introduced concurrently and combined is known as the “two-bucket” defluoridation procedure. Flocculation occurs after quick mixing, gradual stirring, and settling for roughly 1 hour. Few observations have shown that the fluoride trapped in the flocs may be released back into the water; hence, the two buckets are utilized to guarantee that the treated water is quickly separated. 440

10.2 Indian scenario

11. role of the dentist in fluorosis mitigation.

Combating skeletal fluorosis on a large scale remains a severe challenge due to the lack of awareness and costly therapy. Thus, research should focus on developing cost-effective and straightforward methods for treating skeletal fluorosis or removing this element from drinking water.

Not only does public knowledge play an essential role in the containment of this huge hazard, but also government and non-governmental organizations. As part of their curriculum, pupils are taught fluorosis mitigation measures, as an effort of the Rajasthan Government in India to raise awareness among young people. During regular surveys, public health officials should come across afflicted patients. It is necessary to organize camps and programs to educate the public and raise awareness about the dangers of fluorosis and the need to drink healthy water. In locations where water seems to be the primary cause of skeletal fluorosis, and there is no alternative water supply and health insurance, and thus the medical community should be educated to handle this issue and limit its effects. The National Rural Health Insurance Program is one such insurance scheme (under NRHM). Besides the steps mentioned above, healthcare staff should be well trained to diagnose fluorosis and prevent preventative actions accurately.

12. Perspective and future research direction

(1) There is little literature study on the data on fluoride levels in the environment and the monitoring of it. Furthermore, there is no recent literature study.

(2) Water contamination with fluoride ions is a significant health-related problem in arid and semi-arid areas. The fluoride concentration in groundwater is 20 mg L −1 and even more in some regions of China, India, and North Africa. This level is considerably more than the limit set by WHO, which is 1.5 mg L −1 .

(3) The contaminants in drinking water lead to various disease and health-based issues such as skeletal, dental, and non-skeletal fluorosis, which is caused by fluoride in groundwater. Because of its effect, WHO has limited the concentration of fluoride to 1.5 mg L −1 , and the BIS has determined it to be less than 1 mg L −1 .

(4) Various methods for fluoride ion removal have been proposed for reducing its acuity towards damage to human health and the environmental risk. However, due to the high variability of fluoride in drinking water, the conventional methods are expensive and inadequate. Hence, there is an urgent need to develop efficient and cheap strategies for fluoride water treatment.

(5) Many technologies are shown on the laboratory scale. However, wastewater with a high fluoride concentration has a critical effect on the environment and human health. This is later worsened by the inter-connection of the water-based ecosystem, which causes the toxic fluoride to be consumed in food and during recreational activities.

(6) Developing highly efficient and enhanced methods is required to generate more sanitation and treatment abilities. The developing techniques show higher potential for the 6th UNSDG.

(7) According to the literature, there is not enough data for interpolating or extrapolating the information based on different methods. The literature collected from various sources states fluoride removal by employing adsorption. However, there is very little specified about it and limited discussion on the cost-effective adsorbents.

(8) The bioremediation technique is recognized for the indirect use of fluoride-containing effluent in WWT as the organisms have certain requirements and limited fluoride resistance. Bioremediation is integrated with water management by trapping free fluoride on the surface of water, avoiding the leaching of fluoride into the soil. The recent studies suggest the feasibility and sustaining material recovery of fluoride by the process of phytoremediation.

(9) The toxicity of fluoride is minimized through early diagnosis and reduced intake, generating enhanced nutrition in terms of calcium and vitamin D in the diet. Special attention is given to individuals living with painful and vulnerable conditions, resulting in physical, cultural, and social downfall.

(10) Highly developed research studies are needed for developing and implementing cost-effective, hybrid technology and sustaining features to eliminate the problems based on fluoride. Specific knowledge on fluoride disposal from groundwater is lacking, but it is observed that an innovative encapsulation method for fluoride isolation shows minimum risk and has a practical solution, which needs to be developed worldwide.

(11) Defluoridation needs various features to be followed, such as low-cost, highly advanced systems, with low waste, low procedure wastage, and high use of available waste on a large-scale basis.

(12) The content of fluoride arises from the food chain, and hence the nutritional status of most Indians is inferior. According to the facts listed, it is observed that fluoride contamination in India needs to be minimized to avoid hazardous health issues.

13. Conclusion

Abbreviations, author contributions, conflicts of interest, acknowledgements, notes and references.

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

• View all journals
• My Account Login
• Explore content
• About the journal
• Publish with us
• Sign up for alerts
• Open access
• Published: 01 June 2024

Dental public health

Fluoride and children’s IQ: evidence of causation lacking

• Deborah Moore   ORCID: orcid.org/0000-0001-9965-9371 1 &
• Anne-Marie Glenny 2  

Evidence-Based Dentistry ( 2024 ) Cite this article

15 Accesses

Metrics details

• Fluoridation

Data sources

Human, animal, and in vitro studies. Extensive literature search of multiple bibliographic databases, trial registries, major grey literature sources and bibliographies of identified studies.

Study selection

The authors aimed to identify studies which could be used to determine the maximum safe level for fluoride in drinking water. To identify new studies published since a 2016 Australian review, the search period was 2016 to July 2021. Studies which evaluated the association between either naturally or artificially fluoridated water (any concentration) and any health outcomes were included. No restrictions on study design or publication status. Articles published in a ‘non-Latin language’ were excluded. Screening of abstracts and full texts was in duplicate. For IQ and dental fluorosis, a top-up search was conducted between 2021 and Feb 2023.

Data extraction and synthesis

Extensive data extraction. Risk of bias assessment using the OHAT tool. A narrative synthesis of the results was carried out.

The review included 89 studies in humans, 199 in animals and 10 reviews of in vitro studies. Where there was consistent evidence of a positive association, in relation to a water fluoride concentration of <20 ppm (mg F/L), and where studies were judged to be acceptable or high quality, health effects were taken forwards for further examination of causality using Bradford Hill’s 9 criteria. Of the 39 health outcomes reviewed, 4 were further assessed for causality. The authors reported ‘strong’ evidence of causality for dental fluorosis and reductions in children’s IQ scores, ‘moderate’ strength evidence for thyroid dysfunction, ‘weak’ for kidney dysfunction, and ‘limited’ evidence for sex hormone disruption.

Conclusions

The authors conclude that moderate dental fluorosis and reductions in children’s IQ scores are the most appropriate health outcomes to use when setting an upper safe level of fluoride in drinking water. For reductions in children’s IQ, the authors acknowledge a biological mechanism of action has not been elucidated, and the dose response curve is not clear at lower concentrations, limiting the ability to set an upper safe threshold.

A Commentary on

Taher M K, Momoli F, Go J et al .

Systematic review of epidemiological and toxicological evidence on health effects of fluoride in drinking water. Crit Rev Toxicol 2024 54 2–34.

The safety of water fluoridation has been frequently questioned and concerns have been raised about many different health effects. Recently, studies investigating neurodevelopment and IQ have generated increasing attention. In the USA, there is an ongoing court case ‘Food & Water Watch, Inc. et al. v. Environmental Protection Agency (EPA) et al.’ in which the plaintiffs, a coalition of anti-fluoridation groups, claim that fluoride poses an ‘unreasonable risk’ to health on the grounds that it is neurotoxic, and should be regulated as such under the Toxic Substances Control Act of 1976 (TSCA) 1 .

A key piece of evidence in the trial is a US National Toxicology Programme (NTP) systematic review of fluoride exposure and neurodevelopmental and cognitive health effects. The NTP systematic review was started in 2016 and the first draft (2019) concluded that “fluoride is presumed to be a cognitive neurodevelopmental hazard to humans”. The US National Academies of Science, Engineering and Medicine (NASEM) have twice peer reviewed the draft NTP review and requested revisions on the basis that the conclusions were not adequately supported by the evidence 2 .

An important issue is that many of the studies demonstrating adverse effects of fluoride on IQ are related to very high naturally occurring water fluoride concentrations, far higher than the recommended (and legal, in the UK and Europe) maximum of 1.5 mg F/L, and the 1 mg F/L target for water fluoridation programmes. Additionally, many studies have been conducted in developing countries in populations who may also be exposed to environmental pollutants such as lead, mercury or arsenic through contaminated drinking water or coal smoke pollution 2 , 3 . At the time of writing, the final NTP review has not been published, however, the most recently available third draft (Sept 2022) is more cautious, stating with “moderate confidence” that “higher fluoride exposure… [>1.5 mg F/L] is consistently associated with lower IQ in children”, and acknowledges that “more studies are needed to fully understand the potential for lower fluoride exposure [<1.5 mg F/L] to affect children’s IQ” 4 .

This brings us back to the present systematic review, by Taher et al. 5 . In terms of the methods, the scope of the review is extensive. The main manuscript is 29 pages, and there are over 1000 pages of supplementary materials. It is therefore surprising that there is no indication that the review protocol was registered in advance, important to maintain rigour and reduce bias. Relatedly, there is no justification given for the ‘top-up search’ between 2021 and Feb 2023, for only IQ-effects studies. It is not clear that data extraction was performed in duplicate, or that the data extraction forms were piloted. Indeed, a large volume of information has been extracted but not all of it is used in the analysis or manuscript, and there are some reporting inconsistencies.

Our main area of concern reflects the risk of bias assessment and how it has been applied. The authors used the OHAT Tool for Human and Animal Studies. A requirement of the tool is that important confounding factors should be agreed in advance with subject matter experts, for each health outcome. There is no indication that this was done, therefore we have limited confidence in the authors’ assessment as we are not sure what confounders they would expect to be considered as a minimum. In addition, the study summary table in the main manuscript presents study type, country, and direction of association for each health outcome, but does not include any indication of the strength of the association or the water fluoride concentration, which makes it difficult to evaluate the relevance of the findings to water fluoridation programmes.

The human evidence included in the Taher review overlaps with the draft NTP review 4 , and other systematic reviews on the neurological and health effects of fluoride in water, including a recent Irish government review (Lambe et al. 6 ), and a Canadian government review (CADTH) 7 . There appear to be differing perspectives on the quality of this evidence from reviewers with a toxicology perspective (Taher et al. 5 and the draft NTP review), versus those with an evidence-based medicine perspective 6 , 7 . The latter have stated that the current evidence base related to IQ is insufficient to draw conclusions, and that further high quality research is needed (Lambe et al. and CADTH) 6 , 7 .

To illustrate, a Canadian prospective cohort study by Till. et al. 8 , assessed as ‘high quality / low risk of bias’ by both Taher et al. and the draft NTP review 4 , was assessed as ‘low quality / high risk of bias’ by the Lambe et al. and CADTH reviews 6 , 7 . Bias concerns stated were: selection bias (low participation rate, high loss to follow-up); validity of the fluoride and IQ measurements; and insufficient adjustment for confounding, including by maternal IQ and marital status 6 , 7 . Similar differences in risk of bias assessments are evident for other papers included in the multiple reviews. The paper by Till et al. (2020) uses data from the Maternal-Infant Research on Environmental Chemicals (MIREC) birth cohort database in Canada, as do several other recent fluoride-IQ papers (including Farmus et al. 9 , also assessed as high quality by Taher et al., and low quality by Lambe et al. 6 ). The MIREC cohort was not designed to evaluate fluoride and the studies using these data have been extensively critiqued 2 , 10 , with recent authors stating that these studies should be “considered unacceptable for legal and policy purposes” 11 .

In conclusion, there is ongoing and high-profile debate regarding the impact of fluoride in drinking water on IQ, with very different perspectives on bias according to discipline. High-quality prospective longitudinal studies based on individual-level exposures, in populations exposed to fluoride concentrations of relevance to fluoridation programmes, and taking account of all important confounding factors are necessary to provide higher-quality information.

Practice Points

Practitioners may need to respond to patient concerns regarding the neurodevelopmental toxicity of fluoride in drinking water.

Recent proposals to extend water fluoridation in the North East of England mean this issue is very topical.

Practitioners should be aware the evidence base is much disputed with ongoing concerns regarding the validity, applicability, and risk of bias in many of the studies.

Court Listener. Food & Water Watch, Inc. et al. v. Environmental Protection Agency et al. (3:17-cv-02162). 2024 [cited 2024 Apr 10]. Available from: https://www.courtlistener.com/docket/6201332/food-water-watch-inc-v-environmental-protection-agency/?filed_after=&filed_before=&entry_gte=&entry_lte=&order_by=desc

National Academies of Science Engineering and Medicine. Review of the Revised NTP Monograph on the Systematic Review of Fluoride Exposure and Neurodevelopmental and Cognitive Health Effects: A Letter Report (2021). The National Academies Press; 2021 [cited 2023 Jan 11]. Available from: https://nap.nationalacademies.org/catalog/26030/review-of-the-revised-ntp-monograph-on--thesystematic-review-of-fluoride-exposure-and-neurodevelopmental-and-cognitive-health-effects

Choi AL, Sun G, Zhang Y, Grandjean P. Developmental fluoride neurotoxicity: a systematic review and meta-analysis. Environ Health Perspect. 2012;1362:1362–8.

Article   Google Scholar  

National Toxicology Program, Public Health Service, U.S. Department of Health and Human Services. DRAFT NTP Monograph on the State of the Science Concerning Fluoride Exposure and Neurodevelopmental and Cognitive Health Effects: A Systematic Review. 2022. [cited 2024 Apr 10]. Available from: https://ntp.niehs.nih.gov/sites/default/files/ntp/about_ntp/bsc/2023/fluoride/documents_provided_bsc_wg_031523.pdf

Taher MK, Momoli F, Go J, et al. Systematic review of epidemiological and toxicological evidence on health effects of fluoride in drinking water. Crit Rev Toxicol. 2024;54:2–34.

Article   CAS   PubMed   Google Scholar  

Lambe K, Farragher A, Moloney T, Sunday S, Long J. Impact of community water fluoridation on systemic health excluding oral health An evidence review. Health Research Board. 2022. https://www.hrb.ie/publications/publication/impact-of-community-water-fluoridation-on-systemic-health-excluding-oral-health-an-evidence-review/returnPage/1/ [cited 2023 Jan 11].

CADTH. Community Water Fluoridation Exposure: A Review of Neurological and Cognitive Effects – A 2020 Update. 2020 [cited 2024 Apr 9]. p. 1–42. Available from: https://www.ncbi.nlm.nih.gov/books/NBK567579/

Till C, Green R, Flora D, Hornung R, Martinez-Mier EA, Blazer M. Fluoride exposure from infant formula and child IQ in a Canadian birth cohort. Environ Int 2020;134:105315.

Farmus L, Till C, Green R, Hornung R, Martinez-Mier EA, Ayotte P. Critical windows of fluoride neurotoxicity in Canadian children. Environ Res. 2021;200:111315.

Tomar S, Bedi R, Curtis D, Carter N, Douglas G, Caulfield T, et al. Letter of concern to National Institute of Environmental Health Sciences regarding Green et al. study (2019). 2019. [cited 2022 Dec 7]. Available from: https://www.asdwa.org/wp-content/uploads/2019/10/NIEHSLetter10-23-19.pdf

Guichon J, Cooper C, Rugg-Gunn A, Dickinson J. Flawed MIREC fluoride and intelligence quotient publications: A failed attempt to undermine community water fluoridation. Commun Dent Oral Epidemiol. 2024. https://onlinelibrary.wiley.com/doi/10.1111/cdoe.12954 [cited 2024 Apr 12].

Download references

Author information

Authors and affiliations.

Senior Clinical Lecturer / Honorary Consultant in Dental Public Health, The University of Liverpool, Liverpool, UK

Deborah Moore

Professor of Health Sciences Research, The University of Manchester, Manchester, UK

Anne-Marie Glenny

You can also search for this author in PubMed   Google Scholar

Corresponding author

Correspondence to Deborah Moore .

Ethics declarations

Competing interests.

The authors declare no competing interests.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ .

Reprints and permissions

About this article

Cite this article.

Moore, D., Glenny, AM. Fluoride and children’s IQ: evidence of causation lacking. Evid Based Dent (2024). https://doi.org/10.1038/s41432-024-01022-6

Download citation

Received : 12 April 2024

Accepted : 15 April 2024

Published : 01 June 2024

DOI : https://doi.org/10.1038/s41432-024-01022-6

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

Quick links

• Explore articles by subject
• Guide to authors
• Editorial policies

• Share full article

Advertisement

Supported by

Is Fluoridated Drinking Water Safe for Pregnant Women?

New research suggests a link between prenatal fluoride levels and behavioral issues in children. Experts are divided on the study’s significance.

By Alice Callahan and Christina Caron

A small study published Monday suggested that higher levels of fluoride consumed during the third trimester of pregnancy were associated with a greater risk of behavioral problems in the mothers’ children at 3 years old. The authors of the study, which was funded in part by the National Institutes of Health and the Environmental Protection Agency and published in the journal JAMA Network Open, believe it is the first to examine links between prenatal fluoride exposure and child development among families living in the United States, where fluoride is often added to community water supplies to prevent dental cavities.

The study’s authors and some outside researchers said that the findings should prompt policymakers to evaluate the safety of fluoride consumption during pregnancy.

“I think it’s a warning sign,” said Dr. Beate Ritz, an environmental epidemiologist at the U.C.L.A. Fielding School of Public Health.

But other experts cautioned that the study had several important limitations that made it difficult to assess the potential effects of fluoride consumption during pregnancy.

“There is nothing about this study that alarms me or would make me recommend that pregnant women stop drinking tap water,” said Dr. Patricia Braun, a professor of pediatrics at the University of Colorado School of Medicine and a spokesperson for the American Academy of Pediatrics.

The Background

Fluoride strengthens tooth enamel, and research suggests that drinking water with added fluoride can reduce cavities by up to 25 percent . Many communities in the United States have added fluoride to their water for this reason since the 1940s, a practice widely celebrated as a major public health achievement . In 2020, 63 percent of people in the United States lived in areas with at least 0.7 milligrams per liter of fluoride in the water — considered optimal for cavity prevention — though some areas have levels that are higher , in part because of naturally high fluoride in the groundwater.

In the last few years, several studies from Mexico and Canada have suggested that fluoride exposure during pregnancy is linked to slightly lower scores on intelligence tests and other measures of cognitive function in children.

But recent studies from Spain and Denmark have found no such link.

There is a “contentious debate” about water fluoridation, acknowledged Ashley Malin, an assistant professor of epidemiology in the College of Public Health and Health Professions at the University of Florida and the lead author of the new study. The issue is currently the subject of a lawsuit filed by the nonprofit Food and Water Watch and other groups against the Environmental Protection Agency. The nonprofit claims that water fluoridation poses a risk to children’s health.

The Research

The study looked at a group of 229 predominantly low-income Hispanic pregnant women in Los Angeles who were already being followed in other research. Most of the women lived in areas with fluoridated water. The researchers measured the fluoride levels in their urine in a single test during the third trimester. Then, when their children were 3 years old, the mothers filled out the Preschool Child Behavior Checklist , a measure used to detect emotional, behavioral and social problems.

Overall, 14 percent of the children had a total score in the “borderline clinical” or “clinical” range, meaning that a doctor may want to watch or evaluate them, or provide additional support, Dr. Malin said. And on average, higher fluoride levels in the mothers’ urine were correlated with a greater risk of behavioral problems in the children. The researchers found that women with urine fluoride levels at the 75th percentile were 83 percent more likely to have children with borderline or clinically significant behavioral problems than women with levels at the 25th percentile.

The main problems reported by the mothers were emotional reactivity, which is the tendency to overreact; somatic complaints, such as headaches and stomachaches; anxiety; and symptoms linked to autism (though those symptoms alone would not be enough for an autism diagnosis).

The researchers did not find an association with other behavioral symptoms like aggression or issues with concentration.

The findings are important and add to evidence suggesting prenatal fluoride consumption may affect the developing brain, said Joseph Braun, a professor of epidemiology and the director of the Center for Children’s Environmental Health at Brown University, who was not involved in the research. That said, the increases in behavioral scores were relatively small — about two points on a scale from 28 to 100 for overall behavioral problems. It’s hard to say whether such a difference might be noticeable in an individual child, he said.

But given how widespread water fluoridation is, he added, even minor behavioral changes in individual children could have a meaningful impact on the overall population.

The Limitations

The study was relatively small and didn’t include a diverse group of women. It didn’t account for many factors that can affect child development, including genetics , maternal nutrition, home environment and community support, several experts not involved in the study said.

The data would also have been stronger if the researchers had measured fluoride in urine samples from several points of time during pregnancy and collected information on tap water, bottled water and tea consumption to better understand how each contributed to the women’s fluoride levels, experts said. Black and green teas can contain high levels of fluoride.

The Preschool Child Behavior Checklist that was used to evaluate the 3-year-olds is considered a reliable measure of child behavior. But it did not take into account the fact that symptoms can change in frequency and intensity during early childhood, said Catherine Lord, an expert on autism and related disorders at the University of California, Los Angeles medical school.

Dr. Lord, who was not involved in the fluoride research, added that the checklist is not considered a reliable way to diagnose autism.

It would also be helpful to follow the children to see if the problematic behaviors persisted beyond age 3, said Melissa Melough, an assistant professor of nutrition sciences at the University of Delaware, who was not involved in the research.

What’s Next

While the experts agreed that more robust research was needed to untangle the potential effects of prenatal fluoride exposure, they had differing opinions about the study’s bottom line.

Dr. Malin said that, based on her findings and the evidence from previous studies, it might be a good idea for women to limit fluoride intake during pregnancy, a view that was echoed by Dr. Ritz and others.

“For me, the takeaway is: Protect pregnancy,” said Marcela Tamayo-Ortiz, an environmental epidemiologist at the Columbia University Mailman School of Public Health who has studied prenatal exposures for more than two decades.

But the American Dental Association said in a statement that the organization stands by its recommendation to “brush twice a day with fluoride toothpaste and drink optimally fluoridated water.”

And Dr. Nathaniel DeNicola, an OB-GYN and environmental health expert in Orange County, Calif., said he wouldn’t advise his pregnant patients to avoid fluoridated water based on the study, because “it’s not conclusive.”

Dr. Melough said she didn’t think women should be alarmed by the findings. But, she added, while it’s clear that fluoride helps to reduce cavities, it’s possible that adding it to the water “could have some unintended consequences,” and policymakers should continually evaluate the practice as new science emerges.

You can find out what the fluoride levels are in your local water by contacting your water utility or checking the C.D.C.’s My Water’s Fluoride website . If you want to reduce your fluoride consumption, experts said, limit how much black or green tea you drink. You can also purchase certain water filters that remove some fluoride. There’s no reason to stop brushing your teeth with fluoride toothpaste — just don’t swallow it.

Alice Callahan is a Times reporter covering nutrition and health. She has a Ph.D. in nutrition from the University of California, Davis. More about Alice Callahan

Christina Caron is a Times reporter covering mental health. More about Christina Caron

• Open access
• Published: 01 June 2024

Fluoride impairs vascular smooth muscle A7R5 cell lines via disrupting amino acids metabolism

• Yan-Shu Li 1   na1 ,
• Ru-Ru Yang 2   na1 ,
• Xin-Ying Li 1   na1 ,
• Wei-Wei Liu 3   na1 ,
• Yi-Ming Zhao 4 ,
• Ming-Man Zu 2 ,
• Yi-Hong Gao 1 ,
• Min-Qi Huo 1 ,
• Yu-Ting Jiang 2 &
• Bing-Yun Li   ORCID: orcid.org/0000-0002-9343-3248 1  

Journal of Translational Medicine volume  22 , Article number:  528 ( 2024 ) Cite this article

12 Accesses

Metrics details

Given the insidious and high-fatality nature of cardiovascular diseases (CVDs), the emergence of fluoride as a newly identified risk factor demands serious consideration alongside traditional risk factors. While vascular smooth muscle cells (VSMCs) play a pivotal role in the progression of CVDs, the toxicological impact of fluoride on VSMCs remains largely uncharted. In this study, we constructed fluorosis model in SD rats and A7R5 aortic smooth muscle cell lines to confirm fluoride impaired VSMCs. Fluoride aggravated the pathological damage of rat aorta in vivo. Then A7R5 were exposed to fluoride with concentration ranging from 0 to 1200 μmol/L over a 24-h period, revealing a dose-dependent inhibition of cell proliferation and migration. The further metabolomic analysis showed alterations in metabolite profiles induced by fluoride exposure, notably decreasing organic acids and lipid molecules level. Additionally, gene network analysis underscored the frequency of fluoride's interference with amino acids metabolism, potentially impacting the tricarboxylic acid (TCA) cycle. Our results also highlighted the ATP-binding cassette (ABC) transporters pathway as a central element in VSMC impairment. Moreover, we observed a dose-dependent increase in osteopontin (OPN) and α-smooth muscle actin (α-SMA) mRNA level and a dose-dependent decrease in ABC subfamily C member 1 (ABCC1) and bestrophin 1 (BEST1) mRNA level. These findings advance our understanding of fluoride as a CVD risk factor and its influence on VSMCs and metabolic pathways, warranting further investigation into this emerging risk factor.

Fluoride is naturally abundant in the earth's crust and continuously forms in soil and aquifer sediments [ 24 ]. As a result, humans often unknowingly consume excessive amounts of fluoride through water and various food sources, and fluorosis is more prevalent in areas where water fluoridation cannot be consistently monitored. According to the World Health Organization guideline, which recommends a fluoride concentration of 1.5 mg/L in drinking water, an estimated 63–330 million people are at risk of exposure to fluoride levels exceeding this threshold [ 32 ]. Furthermore, in the Eastern Africa Rift Valley System, the mean fluoride content in foods like potatoes, beans, and peas has surpassed the recommended dietary allowances level of 4 mg/kg endorsed by the US Institute of Medicine. This elevated fluoride intake may pose a health threat, particularly to young children, male populations, or individuals engaged in high levels of physical activity [ 26 ]. Notably, fluoride primarily accumulates in the body and predominantly travels through the bloodstream, with blood fluoride concentrations peaking within one hour after ingestion. Importantly, this process is not constrained by the total fluoride mass in the body [ 5 , 16 ]. In addition to causing dental and skeletal fluorosis, high levels of fluoride exposure from drinking water (F −  ≥ 3.01 mg/L) has been linked to cardiovascular diseases (CVDs). The residents living in fluoride endemic areas for at least 10 years had higher risk of suffering impaired aortic elasticity, hypertension, and carotid atherosclerosis [ 37 , 38 , 44 ]. Given the stealthy nature and high fatality rate of CVDs, it is imperative to take the newly identified risk of fluoride seriously, alongside conventional risk factors.

When vascular injury occurs or the vascular microenvironment undergoes changes, even subtle shear stress can trigger a transition in vascular smooth muscle cells (VSMCs). These cells shift from a quiescent contractile phenotype to a highly mobile and proliferative synthetic phenotype, a process that forms the pathological foundation of vascular diseases [ 7 , 10 , 35 ]. Emerging evidence suggests a strong correlation between VSMC metabolism and phenotype switching, as well as CVDs such as hypertension and atherosclerosis [ 9 , 45 ]. Glucose metabolism is pivotal for all organisms with regard to VSMC function. In rat aortic smooth muscle cell lines (A7R5), the overexpression of glucose transporter 1 (GLUT1) leads to an increased flux of glucose through glycolysis and the tricarboxylic acid (TCA) cycle, promoting VSMCs proliferation via producing ATP [ 20 , 53 ]. Glycolysis, as the primary metabolic pathway, accounts for over 90% of glucose utilization in VSMCs. Key glycolytic enzyme hexokinase 2 (HK2) plays a crucial role in regulating glycolytic activity and the transition of VSMCs phenotypes in vitro [ 43 , 47 , 49 ]. Additionally, the composition of fatty acids, essential components of cell structure and function, can impact VSMCs in terms of proliferation, migration, and differentiation. The elongation of long-chain fatty acid member 6 (Elovl6), which increases palmitate and reduces oleate, regulates VSMC phenotype switching through reactive oxygen species (ROS) and AMP-activated protein kinase (AMPK) [ 39 ]. Palmitic acid also inhibits the transition of VSMCs to a synthetic phenotype by upregulating miR-22, highlighting the potential of correcting fatty acid metabolism as a treatment approach for vascular diseases [ 13 ]. Furthermore, studies have shown that amino acids, such as glutamine and arginine, participate in maintaining cellular redox balance in VSMCs [ 28 , 30 ]. In cases of metabolic syndrome, certain molecules like fatty acids, leptin, and oxidized lipoprotein particles induce VSMC proliferation by activating the generation of ROS [ 23 ]. These observations suggest that minor alterations in metabolites are intricately linked to VSMC functionality.

Metabolomics serves as a rapid and highly sensitive approach for the investigation of a multitude of differentially abundant metabolites (DAMs). While the toxic effects of fluoride on serum [ 19 , 50 ], tissues [ 52 ] and cells [ 51 ] are gradually emerging, there is a notable absence of information regarding the metabolites in VSMCs exposed to fluoride. This study seeks to uncover changes in metabolites within VSMCs treated with fluoride, with the hope of offering novel insights and potential avenues for future research, possibly leading to more effective therapies.

Animals, treatments and fluoride determination

40 male 3-week-old Sprague–Dawley rats were purchased from Beijing Vital River Laboratories (Beijing, China) and were allowed to acclimatize for a week in a humidity-controlled room with a 12 h light/dark cycle. The rats have free access to the maintenance fodder (Beijing Vital River Laboratories) and sterilized distilled water provided by animal feeding institution. Subsequently, these rats were randomly divided into 4 groups, which were control group (sterilized distilled water), 50 mg/L, 100 mg/L, 150 mg/L fluorinated water, respectively. After 24 weeks of feeding, thoracic aortas were obtained and fixed with 10% methanal for pathological examination. Urine of rats was measured by fluoride ion selective electrode method [ 22 ] to reflect fluoride exposure in rats. All animal procedures were approved by the Animal Care and Use Committee of Harbin Medical University, Harbin, China (NO. hrbmuecdc20230501).

Masson staining

The fixed vascular tissue was dehydrated and transparent in gradient alcohol and xylene. Afterwards, they were embedded in paraffin and sectioned (6 μm) by a microtome. Masson staining kit (Solarbio life sciences, Beijing, China) was used to observe the damage of vascular smooth muscle layer. Olympus microscope was used to capture the images of vascular masson staining slices.

Cells viability

Rat aortic smooth muscle cell lines (A7R5) were procured from Meisen Chinese Tissue Culture Collections (Meisen CTCC) and maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, GIBCO) and 1% antibiotic–antimycotic (GIBCO), with incubation at 37 °C in a 5% CO 2 atmosphere.

During the logarithmic growth phase, VSMCs were seeded at a density of 5000 cells per well in 96-well plates and allowed to adhere for 24 h. Following this, the VSMCs were subjected to various concentrations of NaF for 24 h. The original culture medium was subsequently removed, and each well received 200 µL of 10% CCK-8 reagent. The plate was then incubated at 37 °C for 30 min, and absorbance was measured at 450 nm (Bio Tek Instruments Inc., Highland Park, Vermont, USA). Cell viability was expressed as a percentage relative to untreated control cells, calculated using the following formula: Cell viability (%) = (OD450 of experimental groups—OD450 of the blank group) / (OD450 of the control group—OD450 of the blank group) × 100%.

Scratch wound healing assay

Cells were initially seeded at a density of 5 × 10 5 cells per well in a 6-well culture plate and cultured for an additional 24 h until they reached approximately 80% confluence. Subsequently, a straight-line scratch was made across the plate using a sterilized 10-μL pipette tip. After thorough washing with DMEM, the cells were incubated for 24 h at 37 °C in DMEM containing various concentrations of NaF and 2% FBS. Images of the scratched cells were captured at both 0 h and 24 h using a microscope (U-LH100-3, OLYMPUS). The wound area was quantified using ImageJ (NIH, USA), and the extent of migration was determined by measuring the gap closure area between the 0-h and 24-h time points. The calculation formula for assessing cell migration ability was as follows: closed wound area (%) = (0-h area—24-h area) / 0-h area × 100%.

Metabolomic analysis

Until A7R5 reached approximately 80% confluence, the cells which were treated with DMEM and fluoridated DMEM for 24 h were first rinsed twice with pre-cooled PBS (n = 6). Subsequently, the cells were detached by adding an appropriate amount of trypsin and incubating for 2 min to collect them into a centrifuge tube. After centrifugation at 1000 g and 4 °C for 1 min, the cell pellet was promptly quenched with liquid nitrogen. Quality control (QC) samples were prepared by pooling 10 µL of each sample and analyzed together with the other samples to correct any deviations in the test system.

For the LC–MS/MS analysis, we utilized a UHPLC system (Agilent Technologies 1290 Infinity LC) coupled to a quadrupole time-of-flight mass spectrometer (AB Sciex TripleTOF 6600) at Shanghai Applied Protein Technology Co., Ltd. HILIC separation was performed using a 2.1 mm × 100 mm ACQUITY UPLC BEH Amide column with 1.7 µm particle size (Waters, Ireland). In both ESI positive and negative ionization modes, the mobile phase consisted of A (25 mM ammonium acetate and 25 mM ammonium hydroxide in water) and B (acetonitrile). The gradient started at 95% B for 0.5 min, then gradually decreased to 65% over 6.5 min, followed by a reduction to 40% in 1 min, maintained for 1 min, and finally raised back to 95% in 0.1 min, with a 3-min re-equilibration period.

The ESI source conditions were configured as follows: Ion Source Gas1 (Gas1) at 60, Ion Source Gas2 (Gas2) at 60, curtain gas (CUR) at 30, source temperature at 600 °C, and IonSpray Voltage Floating (ISVF) at ± 5500 V. In MS-only acquisition, the instrument was set to scan the m/z range from 60 to 1000 Da, with an accumulation time of 0.20 s per spectrum. For the auto MS/MS acquisition, the instrument covered the m/z range from 25 to 1000 Da, with an accumulation time of 0.05 s per spectrum for the product ion scan. The product ion scan was performed using information-dependent acquisition (IDA) in high sensitivity mode. The parameters for IDA were as follows: collision energy (CE) was set at a fixed value of 35 V with ± 15 eV; declustering potential (DP) at 60 V for positive mode and − 60 V for negative mode; exclusion of isotopes within 4 Da, and 10 candidate ions monitored per cycle.

Quantitative real-time PCR

Until A7R5 reached approximately 80% confluence, the cells which were treated with DMEM and fluoridated DMEM for 24 h were used to extract total mRNA by TRIZOL reagent. Quantitative real-time PCR (qRT-PCR) analysis was carried out to evaluate RNA expression in control and fluoride treated A7R5 (n = 3). cDNA was synthesized with the Prime Script RT Reagent Kit with gDNA Eraser reverse transcriptase (Takara Bio, Dalian, China). qRT-PCR reactions were conducted with the SYBR Green kit (Takara). Data were normalized to GAPDH as the reference genes for mRNAs. The primer sequences used are provided as followed: ACTCCCATTCTTCCACCTTTG and CCCTGT.

TGCTGTAGCCATATT for GAPDH mRNA; AGGAGTTTCCCTGTTTCTGATG and GCAACTGGGATGACCTTGATA for OPN mRNA; AAGGACAGCTATGTGGGGGA and CGTTAGCAAGGTCGGATGCT for α-SMA mRNA; TGCAAGCAGGCTTTATGACTC and CAGTGTCCCTGATTCGACCT for BEST1 mRNA; ATTGTCATGAGTGGCGGCAA and CTTCCCTAAACCACTGACACCA for ABCC1 mRNA.

The raw metabolomics data were initially processed using ProteoWizard MSConvert, followed by subsequent analysis utilizing the R package (ropls). The processed data underwent multivariate data analysis, encompassing Pareto-scaled principal component analysis (PCA) and orthogonal partial least-squares discriminant analysis (OPLS-DA). The Variable Importance in the Projection (VIP) value was computed for each variable within the OPLS-DA model to assess its contribution to the classification. Metabolites with VIP value exceeding 1 and P-value less than 0.05 were identified as significantly altered. Quantitative data were presented as the mean ± standard deviation (SD). To determine the significance of differences among multiple groups of independent samples, one-way Anova was employed. The significance level was set at P  < 0.05 to establish statistical significance and statistics were calculated with SPSS 19.0.

Fluoride exposure induces pathological alteration of rat aortic media

As shown in Fig.  1 A, the body weight of rats in the fluoride treatment groups was lower than that in the control group after 7 weeks feeding, which showed that fluoride had a certain toxic effect on the growth of rats. The fluorine concentration in 150 mg/L, 100 mg/L and 50 mg/L groups were significantly higher than that in the control group ( P  < 0.05), which indicating that fluorine must be higher than urine fluorine concentration when flowing through blood vessels.

Fluoride impacted on VSMCs in vivo and in vitro. A Rats weight during feeding period. Compared with the control group, * represents all three fluoride treated groups, # represents 150 mg/L fluoride treated group, $ represents 50 and 150 mg/L fluoride treated groups, and & represents 50 and 100 mg/L fluoride treated groups. B Fluoride exposure in rats. * P  < 0.05 versus control. C Pathological alteration of rats’ aortas media with masson staining. D Cell viability assay. VSMCs were treated with various concentrations of NaF for 24 h. Cell viability was assessed by CCK-8 cell proliferation kit. (* P  < 0.05 versus control, n = 4). E Scratch wound assay. Data were quantified by measuring the close area in ( F ) (* P  < 0.05 versus control, n = 3), and presented as mean ± SD. F Representative images of VSMCs scratch wound assay. The closed wound area was quantified by ImageJ (scale bar, 200 µm)

In the control group, VSMCs in the media of rat aorta were well organized and elastic fiber were integrated and continuous. It could be seen from data that with fluoride exposure increasing, the media layer showed progressive disordered VSMCs arrangement, decreased elastic fiber integrity and suspected increased vascular wall fragility (Fig.  1 C). In short, fluoride aggravated the pathological damage of rat thoracic aorta.

Fluoride inhibits VSMC proliferation and wound healing

To identify the optimal fluoride concentration for establishing the cell model, VSMCs were exposed to 0–1350 μmol/L NaF concentrations for 24 h. After treatment with 600, 900 and 1200 μmol/L fluoride for 24 h, the proliferation of VSMC was inhibited to 80%, 53% and 26%, respectively (Fig.  1 D). Vascular smooth muscle cell apoptosis is the driving factor of vascular diseases, in view of apoptosis and survival, NaF dose at 900 μmol/L was implemented in metabolomic analysis and 600, 900 and 1200 μmol/L fluoride was used in wound healing and qRT-PCR.

With the increase of fluoride concentration, the wound healing area gradually decreased, and the scratch healing rates of 0, 600, 900 and 1200 μmol/L fluoride treatment groups were 50%, 21%, 17% and 8%, respectively, indicating that fluoride had an inhibitory effect on the migration ability of VSMC (Fig.  1 E, F).

Metabolomics data quality

Both the experimental samples and the quality control (QC) samples underwent PCA, as depicted in Fig.  2 A, B. The R2X values in positive ion model (PIM) and negative ion model (NIM) were calculated to be 0.558 and 0.607, respectively. These values demonstrated that the QC samples formed tight clusters, indicating the experiment's excellent repeatability. Furthermore, OPLS-DA plots (Fig.  2 C, D) and curves (Fig.  2 E, F) exhibited R2Y and Q2 values of 1 and 0.899 in NIM, and 0.994 and 0.902 in PIM. These values signify the robust predictive capability of our model and indicate that it was not overfitted.

Multidimensional data analysis. PCA score plots ( A , B ) of cellular metabolic profiles in positive and negative ion mode. OPLS-DA score plots ( C , D ) and curves ( E , F ) in positive and negative ion mode

Identification of fluoride treated VSMC metabolites

A comparison between the control group and the fluoride-treated group revealed a large majority of metabolites were identified in PIM and NIM as shown in Fig.  3 A, B. The screening criteria for significance were defined as fold change log2 (FC) > 2 and P < 0.05. Next, the metabolites of VSMC treated by fluoride were analyzed, and the top 10 categories of DAMs were successfully identified, with carboxylic acids and derivatives constituting the largest category at 17.742%, followed by glycerophospholipids at 8.87%, benzene and substituted derivatives at 7.157%, organooxygen compounds at 7.157%, fatty acyls at 6.956%, organonitrogen compounds at 5.04%, steroids and steroid derivatives at 4.234%, prenol lipids at 3.931%, and sphingolipids at 2.016% (Fig.  3 C).

Metabolites identification. A and B Deregulation of metabolites detected in positive ion mode and negative ion mode. C Classification of different identified metabolites. The percentage represents the number of metabolites attribution entry as a percentage of all metabolites

Fluoride mainly disturbed VSMCs amino acids metabolism

To observe the hierarchical clustering results visually, we conducted a heat map to represent, where each column corresponds to a sample and each row represents a specific metabolite. The majority of metabolites in both the fluoride-treated and control groups exhibit well-defined clustering patterns among the samples (Fig.  4 A, B). Among all identified metabolites, 16 metabolites displayed upregulation and 80 metabolites exhibited downregulation, excluding undefined ones in PIM. In NIM, 21 were found to be upregulated, while 46 were downregulated.

Hierarchical clustering and Correlation analysis. A and B Heatmap of the hierarchical clustering of differentially abundant metabolites between fluoride treat group and the control group. Flu, fluoride group; Ctr, control group. N = 6. C and D are top 20 differential metabolites correlation in fluoride exposed group in positive ionization mode and negative ionization mode, respectively. Red represents positive correlation and blue represents negative correlation

Following the exclusion of undefined metabolites, a correlation analysis was conducted to examine the relationships among the top 20 metabolites. In PIM, specifically among organic oxygen compounds (amino acids), 5-aminovaleric acid and alanopine exhibited negative correlations with other metabolites such as amino acids, lipids, nucleosides, and organic nitrogen compounds (Fig.  4 C). Conversely, numerous amino acids including glutamic acid, glycine, D-2-aminobutyric acid, L-aspartic acid, histidine, L-threonine, ectoine, D-proline, DL-glutamine, D-proline, and lysine displayed negative correlations with 5’-phosphoribosyl-5-amino-4-imidazolecarboxamide (AICAR) in NIM. Additionally, there were noticeable positive correlations among these amino acids (Fig.  4 D). It was also observed that, irrespective of the ionization mode, a significant number of DAMs were associated with major energy metabolism processes in fluoride-exposed VSMCs, as detailed in Tables 1 and 2 . Notably, amino acids took the largest proportion among all energy metabolism related metabolites.

DAGs are enriched most in ABC transporters pathway in fluoride treated group

In order to clarify these complex metabolites, the top 20 perturbed metabolic pathways identified in the Kyoto Encyclopedia of Genes and Genomes (KEGG) are presented in Fig.  5 A. Notably, amino acids are frequently enriched in many of these pathways, such as ATP-binding cassette transporters (ABC transporters), arginine and proline metabolism, glycerophospholipid metabolism, alanine, aspartate and glutamate metabolism, glycine, serine and threonine metabolism, etc., which are among those significantly impacted (Fig.  5 A). Furthermore, we presented relative abundance of all DAMs enriched in ABC transporters pathway in Fig.  5 B. Moreover, we detected relative mRNA level of osteopontin (OPN), α-smooth muscle actin (α-SMA), bestrophin 1 (BEST 1) and ATP binding cassette subfamily C member 1 (ABCC1) as an initial validation. Strikingly, compared to the control group, we observed a dose-dependent increase in OPN and α-SMA mRNA level and a dose-dependent decrease in BEST1 and ABCC1 mRNA level (P < 0.05). Altogether, the data suggested that ABC transporters might be involved in modulating VSMCs phenotype switch.

ABC transporters is the most enriched pathway in fluoride treatment group. A The top 20 perturbed metabolic pathways enriched by KEGG. B Relative abundance of DAMs enriched in ABC transporters. C Relative mRNAs level in fluoride-treated VSMCs. * P  < 0.05, versus control group. D Proposed link between amino acids metabolism disturbance and ABC transporters. Eight amino acids in green fonts were downregulated in fluoride treated group. Downward green arrows indicate downregulated efficiency of TCA cycle

This study employed in vivo and in vitro experiments investigate the adverse effects of fluoride on VSMCs. Metabolomics analysis showed a considerable number of DAMs, classified into categories such as lipid and lipid-like compounds, organic acids and derivatives, organic oxygen compounds, and organoheterocyclic compounds, were identified in fluoride-treated VSMCs. A comprehensive analysis of these differential metabolites and enriched pathways revealed that fluoride most frequently disrupts amino acids metabolism in VSMCs. For the first time, this study demonstrates that fluoride primarily hinders VSMCs' proliferation and migration by impeding amino acids metabolism, stemming from disturbances in ABC transporters.

Amino acids metabolism, serving as the foundation for protein synthesis, plays a crucial role by providing essential structural elements and energy sources for biosynthetic reactions [ 21 ]. Previous studies have reported that fluoride exposure can lead to a reduction in amino acids in the heart, liver, and kidney of rats. Specifically, in the heart tissue of rats, L-serine, L-glutamine, L-aspartic acid, and L-glutamic acid exhibited decreased levels [ 52 ]. Consistent with these findings, among the DAMs identified in the fluoride-exposed group, a total of 39 metabolites in both PIM and NIM were found to be involved in amino acids metabolism. Notably, several of these amino acids, including glutamine, glutamic acid, proline, histidine, and arginine, are categorized within the "glutamate family" and are metabolically connected through conversion to glutamate [ 40 ]. Glutamine serves as a pivotal link between carbohydrate and protein carbon metabolism and acts as a primary nitrogen source. Furthermore, glutamine and glutamate participate in the TCA cycle in many forms and are essential constituents of the antioxidant glutathione [ 42 ]. It has shown that supplementation with glutamic acid significantly increases protein synthesis in primary cultures of hepatocytes from elderly rats, effectively doubling the rate in comparison to elderly rats not receiving glutamic acid supplementation [ 4 ]. Additionally, glutathione, a well-known antioxidant, plays a crucial role in combating free radicals to mitigate oxidative stress. In this study, it was observed that the levels of glutathione and metabolites from the "glutamate family" in fluoride-exposed VSMCs were lower than those in the control group, signifying a reduced TCA cycle activity and an elevated oxidative state.

Furthermore, arginine is essential in vascular function as it serves as the substrate for endothelial nitric oxide synthase to generate nitric oxide (NO). This process involves the transportation of arginine into VSMCs via the cationic amino acid transporter family, where it can be metabolized to form NO, polyamines, or L-proline [ 2 ]. When there is a reduction in vascular NO production or when the cyclic guanosine monophosphate-protein kinase G pathway becomes impaired, the vasodilatory function of NO in both macro- and micro-vessels is compromised [ 1 ]. This underscores the critical role of arginine and NO in regulating vascular health and function.

Notably, this study has also revealed a notable decrease in two novel amino acids in fluoride exposed VSMCs. One of these, valine betaine, is a novel betainized compound in humans, and its concentration was substantially reduced in fluoride treated VSMCs. In studies involving mice, the concentration of valine betaine has shown an inverse correlation with postprandial insulin levels [ 17 ]. It's well-established that serum insulin levels can influence VSMC phenotype alterations, proliferation, or apoptosis [ 6 , 11 , 31 ]. Additionally, taurine, another amino acids with anti-inflammatory properties [ 33 ], has been associated with protective effects against coronary heart disease [ 46 ] and CVDs [ 3 ]. Taurine's mechanisms of action include the maintenance of mitochondrial respiratory function and the reduction of superoxide production [ 34 ]. Therefore, fluoride impacts various amino acids in VSMCs, affecting processes like the citric acid cycle, oxidative processes, and other cellular biosynthetic pathways, which can directly or indirectly inhibit VSMC function.

Acetyl-CoA holds significant importance in the TCA cycle, and it can be generated through both glucose and fatty acid metabolism. Acetyl-CoA serves not only as the product of the oxidative decarboxylation of pyruvate but also as the carbon source for lipoic acid synthesis, cholesterol synthesis, and acetone body formation. Glycolysis plays a critical role in activating VSMCs, and its end product, pyruvate, can be converted into lactate or further metabolized to generate acetyl-CoA [ 12 ]. It's worth noting that thiamine facilitates the conversion of pyruvate to acetyl-CoA, serving as an initiator of the TCA cycle [ 15 ]. In this study, we observed decreases in thiamine, lactate, N-acetyl-d-glucosamine (NAG), and D-mannose 6-phosphate in the fluoride-treated group, suggesting an impact of fluoride on VSMC glycolysis. Due to sodium fluoride is a direct inhibitor of the glycolytic enzyme enolase, the relationship between fluoride level and VSMC glycolysis need further research. Within the enriched lipids and lipid-like molecules, acetylcarnitine was identified as decreased in the fluoride-exposed group and was associated with the insulin resistance pathway. Acetylcarnitine plays a role in transferring two-carbon units from mitochondria to the cytosol, supporting acetylation of acetyl-CoA, fatty acid synthesis, and cell growth [ 14 ]. Collectively, in fluoride exposed VSMCs, the most enriched metabolites belong to the amino acid metabolism category, which is closely interconnected with the TCA cycle. Furthermore, several DAMs related to glucose and lipid metabolism point to an impact on acetyl-CoA levels. The TCA cycle is intimately linked to ATP production and mitochondrial function, and fluoride exposure can induce morphological damage in rat cardiomyocytes (H9c2), leading to reduced concentrations of both Ca 2+ and mitochondrial numbers. These findings underscore the intricate mechanisms through which fluoride can disrupt cellular metabolism and function.

In this study, a majority of the KEGG enrichment pathways are closely associated with amino acids metabolism. Pathways such as arginine and proline metabolism, glycine, serine, and threonine metabolism, alanine, aspartate, and glutamate metabolism, histidine metabolism, and arginine biosynthesis is intricately linked to different stages of protein synthesis. Moreover, ABC transporters, recognized as one of the largest superfamilies of conserved proteins, play a pivotal role in actively translocating various molecules, including fatty acids, amino acids, lipids, and proteins [ 41 ]. These transporters are distributed across a wide range of cellular and organelle membranes, including peroxisomes, mitochondria, lysosomes, and the endoplasmic reticulum. Peroxisomal ABC transporters, in particular, facilitate the entry of diverse lipid substrates into peroxisomes, where they are primarily subjected to degradation but also contribute to the synthesis of bioactive lipids that impact membrane composition and signaling pathways. It is worth noting that certain studies have suggested that the secretion of aminoacyl-tRNA synthetases underlies angiogenic responses, although reliable assays for assessing their specific roles in angiogenesis functions are still lacking [ 25 ]. These findings emphasize the complexity of the metabolic pathways and molecular mechanisms at play in VSMCs exposed to fluoride.

In addition, increased synthetic phenotype marker gene α-syn and contractile phenotype marker gene OPN of VSMCs suggested that VSMCs phenotype were impacted, though VSMCs quantity in vitro were inhibited. Based on pathway results, we detected important member of ABC transporters. ABCC1, also known as multidrug resistance protein 1 (MRP1), mediate chemotherapy resistance via efflux cancer drugs in the presence of glutathione [ 8 ]. BEST1 is a member of Ca 2+ -activated chloride channels, holding tremendous biomedical significance [ 29 ]. Functionally, both ABCC1 and BEST1 are responsible for transporting ion, and lower expression of them may increase the accumulation of fluorine in VSMCs. The results are in a way consistent with our previous study that chloride channel 7 in fluoride treated osteoclasts was significantly lower than the control group [ 18 ]. Taken together, the above results provide more evidences regarding the response of VSMCs to fluoride.

While endothelial cells (ECs) are commonly recognized as the primary guardians against vascular diseases, it's essential to appreciate the central role that VSMCs play within the cardiovascular system. The current study provides a comprehensive metabolic profile of VSMCs subjected to fluoride exposure, unveiling a plethora of DAMs and potential research avenues. Cumulatively, these DAMs indicate deviations in amino acids metabolism, impacting the TCA cycle and acetyl-CoA synthesis, which may decrease ATP production and impair mitochondria. Furthermore, the ABC transporters pathway appears to be central to VSMCs disruption due to significant decrease in ATP synthesis, as we proposed in Fig.  5 D.

Our findings undeniably pave the way for a new direction and an intriguing avenue of exploration in the realm of fluoride toxicity research and fluorosis. Nevertheless, it is essential to acknowledge that this study currently lacks robust in vivo verification of the consequences associated with inhibited protein synthesis. Precise experimental evidence is warranted to ascertain whether the toxic effects of fluoride on VSMCs stem from mitochondrial damage, TCA cycle interference, or other factors. Notably, although the concentrations of sodium on VSMCs cytotoxicity in vivo or in vitro have been reported dozens of times more than we used in this study [ 27 , 36 , 48 ], the researchers should consider to add sodium control group to tell the different impact between fluoride and sodium administration.

This study marks a groundbreaking achievement in shedding light on the metabolites and metabolic pathways affected by fluoride in VSMCs. For the first time, we have provided a comprehensive report on these impacts and gained a deeper understanding of their implications. Notably, amino acids belonging to the "glutamate family" emerged as highly enriched components across various pathways. This underscores the significance of amino acids metabolism as a central link in fluoride-induced toxicity in VSMCs. Of particular interest is the observation that multiple pathways related to protein synthesis, and interconnected with amino acids metabolism, exhibited significant enrichment. These encompassed pathways such as ABC transporters and aminoacyl-tRNA biosynthesis, among others. While it's important to acknowledge the study's limitation in using male rats only and lacking in vivo validation of metabolites, our findings undeniably pave the way for a new direction and an intriguing avenue of exploration in the realm of fluoride toxicity research and fluorosis. In particular, whether ABC transporters is a key link in fluoride induced VSMC cytotoxicity will be the focus of in further research.

Availability of data and materials

Data The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Bahadoran Z, Mirmiran P, Kashfi K, Ghasemi A. Vascular nitric oxide resistance in type 2 diabetes. Cell Death Dis. 2023;14:410. https://doi.org/10.1038/s41419-023-05935-5 .

Article   CAS   PubMed   PubMed Central   Google Scholar  

Bakker J, Grover R, McLuckie A, et al. Administration of the nitric oxide synthase inhibitor NG-methyl-L-arginine hydrochloride (546C88) by intravenous infusion for up to 72 hours can promote the resolution of shock in patients with severe sepsis: results of a randomized, double-blind, placebo-controlled multicenter study (study no. 144-002). Crit Care Med. 2004;32:1–12. https://doi.org/10.1097/01.CCM.0000105118.66983.19 .

Article   CAS   PubMed   Google Scholar  

Bosevski M, Bosevska G, Stojanovska L, Apostolopoulos V. CRP and fibrinogen imply clinical outcome of patients with Type-2 diabetes and coronary artery disease. Acta Biochim Biophys Sin (Shanghai). 2017;49:284–5. https://doi.org/10.1093/abbs/gmw135 .

Brodsky VY, Malchenko LA, Lazarev DS, et al. Glutamic acid signal synchronizes protein synthesis kinetics in hepatocytes from old rats for the following several days. Cell metabolism memory. Biochemistry (Mosc). 2018;83:294–8. https://doi.org/10.1134/S0006297918030094 .

Buzalaf MAR, Whitford GM. Fluoride metabolism. Monogr Oral Sci. 2011;22:20–36. https://doi.org/10.1159/000325107 .

Article   PubMed   Google Scholar  

Casella SBA, Mauriello A, Orlandi A. Molecular pathways regulating macrovascular pathology and vascular smooth muscle cells phenotype in type 2 diabetes. Int J Mol Sci. 2015. https://doi.org/10.3390/ijms161024353 .

Article   PubMed   PubMed Central   Google Scholar  

Chiong M, Cartes-Saavedra B, Norambuena-Soto I, et al. Mitochondrial metabolism and the control of vascular smooth muscle cell proliferation. Front Cell Dev Biol. 2014;2:72. https://doi.org/10.3389/fcell.2014.00072 .

Ebner J, Schmoellerl J, Piontek M, et al. ABCC1 and glutathione metabolism limit the efficacy of BCL-2 inhibitors in acute myeloid leukemia. Nat Commun. 2023;14:5709. https://doi.org/10.1038/s41467-023-41229-2 .

Guarner-Lans V, Ramirez-Higuera A, Rubio-Ruiz ME, et al. Early programming of adult systemic essential hypertension. Int J Mol Sci. 2020. https://doi.org/10.3390/ijms21041203 .

Hall JL, Chatham JC, Eldar-Finkelman H, Gibbons GH. Upregulation of glucose metabolism during intimal lesion formation is coupled to the inhibition of vascular smooth muscle cell apoptosis. Role of GSK3beta. Diabetes. 2001;50:1171–9. https://doi.org/10.2337/diabetes.50.5.1171 .

Harith HH, di Bartolo BA, Cartland SP, et al. Insulin promotes vascular smooth muscle cell proliferation and apoptosis via differential regulation of tumor necrosis factor-related apoptosis-inducing ligand. J Diabetes. 2016;8(4):568–78. https://doi.org/10.1111/1753-0407.12339 .

Heiss EH, Schachner D, Donati M, et al. Increased aerobic glycolysis is important for the motility of activated VSMC and inhibited by indirubin-3’-monoxime. Vascul Pharmacol. 2016;83:47–56. https://doi.org/10.1016/j.vph.2016.05.002 .

Hu Y, Fan Y, Zhang C, Wang C. Palmitic acid inhibits vascular smooth muscle cell switch to synthetic phenotype via upregulation of miR-22 expression. Aging. 2022;14:8046–60. https://doi.org/10.18632/aging.204334 .

Izzo LT, Trefely S, Demetriadou C, et al. Acetylcarnitine shuttling links mitochondrial metabolism to histone acetylation and lipogenesis. Sci Adv. 2023;9:eadf0115. https://doi.org/10.1126/sciadv.adf0115 .

Jankowska-Kulawy A, Bielarczyk H, Pawelczyk T, et al. Acetyl-CoA and acetylcholine metabolism in nerve terminal compartment of thiamine deficient rat brain. J Neurochem. 2010;115:333–42. https://doi.org/10.1111/j.1471-4159.2010.06919.x .

Jha SK, Mishra VK, Sharma DK, Damodaran T. Fluoride in the environment and its metabolism in humans. Rev Environ Contam Toxicol. 2011;211:121–42. https://doi.org/10.1007/978-1-4419-8011-3_4 .

Karkkainen O, LANKINEN MA, VITALE M, et al. Diets rich in whole grains increase betainized compounds associated with glucose metabolism. Am J Clin Nutr. 2018;108(5):971–9. https://doi.org/10.1093/ajcn/nqy169 .

Li BY, Gao YH, Pei JR, et al. ClC-7/Ostm1 contribute to the ability of tea polyphenols to maintain bone homeostasis in C57BL/6 mice, protecting against fluorosis. Int J Mol Med. 2017;39:1155–63. https://doi.org/10.3892/ijmm.2017.2933 .

Li L, Lin LM, Deng J, et al. The therapeutic effects of Prunella vulgaris against fluoride-induced oxidative damage by using the metabolomics method. Environ Toxicol. 2021;36:1802–16. https://doi.org/10.1002/tox.23301 .

Lin CY, Hsu SC, Lee HS, et al. Enhanced expression of glucose transporter-1 in vascular smooth muscle cells via the Akt/tuberous sclerosis complex subunit 2 (TSC2)/mammalian target of rapamycin (mTOR)/ribosomal S6 protein kinase (S6K) pathway in experimental renal failure. J Vasc Surg [J]. 2013;57:475–85. https://doi.org/10.1016/j.jvs.2012.07.037 .

Ling ZN, Jiang YF, Ru JN, et al. Amino acid metabolism in health and disease. Signal Transduct Target Ther. 2023;8:345. https://doi.org/10.1038/s41392-023-01569-3 .

Liu Y, Yang Y, Wei Y, et al. sKlotho is associated with the severity of brick tea-type skeletal fluorosis in China. Sci Total Environ. 2020;744:140749. https://doi.org/10.1016/j.scitotenv.2020.140749 .

Lopez-Acosta O, Ruiz-Ramirez A, Barrios-Maya MA, et al. Lipotoxicity, glucotoxicity and some strategies to protect vascular smooth muscle cell against proliferative phenotype in metabolic syndrome. Food Chem Toxicol. 2023;172:113546. https://doi.org/10.1016/j.fct.2022.113546 .

Meenakshi, Maheshwari RC. Fluoride in drinking water and its removal. J Hazard Mater. 2006;137:456–63. https://doi.org/10.1016/j.jhazmat.2006.02.024 .

Mirando AC, Abdi K, Wo P, Lounsbury KM. Assessing the effects of threonyl-tRNA synthetase on angiogenesis-related responses. Methods. 2017;113:132–8. https://doi.org/10.1016/j.ymeth.2016.11.007 .

Nelima D, Wambu EW. KITUYI J L Fluoride distribution in selected foodstuffs from Nakuru County, Kenya, and the risk factors for its human overexposure. Sci Rep. 2023;13:15295. https://doi.org/10.1038/s41598-023-41601-8 .

Olorunnisola OS, Adegbola PI, Ajilore BS, et al. The role of poly-herbal extract in sodium chloride-induced oxidative stress and hyperlipidemia in male wistar rats. Medicines. 2021. https://doi.org/10.3390/medicines8060025 .

Osman I, He X, Liu J, et al. TEAD1 (TEA Domain Transcription Factor 1) promotes smooth muscle cell proliferation through upregulating SLC1A5 (Solute Carrier Family 1 Member 5)-mediated glutamine uptake. Circ Res. 2019;124:1309–22. https://doi.org/10.1161/CIRCRESAHA.118.314187 .

Owji AP, Wang J, Kittredge A, et al. Structures and gating mechanisms of human bestrophin anion channels. Nat Commun. 2022;13:3836. https://doi.org/10.1038/s41467-022-31437-7 .

Park WH, Han BR, Park HK, Kim SZ. Arsenic trioxide induces growth inhibition and death in human pulmonary artery smooth muscle cells accompanied by mitochondrial O2*- increase and GSH depletion. Environ Toxicol. 2018. https://doi.org/10.1002/tox.22569 .

Peng YCP, Zou SF, Jia M, Zhong WT, Wang Y, Wang XK. High dose insulin promotes the proliferation of vascular smooth muscle cells via AP-1/SM-α pathway. J Biol Regul Homeost Agents. 2021;35(3):1029–40. https://doi.org/10.23812/21-201-A .

Podgorski J, Berg M. Global analysis and prediction of fluoride in groundwater. Nat Commun. 2022;13:4232. https://doi.org/10.1038/s41467-022-31940-x .

Qaradakhi T, Gadanec LK, McSweeney KR, et al. The anti-inflammatory effect of taurine on cardiovascular disease. Nutrients. 2020. https://doi.org/10.3390/nu12092847 .

Shetewy A, Shimada-Takaura K, Warner D, et al. Mitochondrial defects associated with beta-alanine toxicity: relevance to hyper-beta-alaninemia. Mol Cell Biochem. 2016;416:11–22. https://doi.org/10.1007/s11010-016-2688-z .

Shi J, Yang Y, Cheng A, et al. Metabolism of vascular smooth muscle cells in vascular diseases. Am J Physiol Heart Circ Physiol. 2020;319:H613–31. https://doi.org/10.1152/ajpheart.00220.2020 .

Simon Y, Jacques D, Bkaily G. High salt-induced morphological and glycocalyx remodeling of human vascular smooth muscle cells is reversible but induces a high sodium salt-like sensitive memory. Can J Physiol Pharmacol. 2023;101:437–46. https://doi.org/10.1139/cjpp-2023-0087 .

Sun L, Gao Y, Liu H, et al. An assessment of the relationship between excess fluoride intake from drinking water and essential hypertension in adults residing in fluoride endemic areas. Sci Total Environ. 2013;443:864–9. https://doi.org/10.1016/j.scitotenv.2012.11.021 .

Sun L, Gao Y, Zhang W, et al. Mechanisms underlying endothelin-1 level elevations caused by excessive fluoride exposure. Cell Physiol Biochem. 2016;40:861–73. https://doi.org/10.1159/000453145 .

Sunaga H, Matsui H, Anjo S, et al. Elongation of long-chain fatty acid family member 6 (Elovl6)-driven fatty acid metabolism regulates vascular smooth muscle cell phenotype through AMP-activated protein kinase/kruppel-like factor 4 (AMPK/KLF4) signaling. J Am Heart Assoc. 2016. https://doi.org/10.1161/JAHA.116.004014 .

Tapiero H, Mathe G, Couvreur P, Tew KD. II. Glutamine and glutamate. Biomed Pharmacother. 2002;56:446–57. https://doi.org/10.1016/s0753-3322(02)00285-8 .

Tawbeh AGC, Trompier D, Savary S. Peroxisomal ABC transporters: an update. Int J Mol Sci. 2021;22(11):6093. https://doi.org/10.3390/ijms22116093 .

Tompkins SC, Sheldon RD, Rauckhorst AJ, et al. Disrupting mitochondrial pyruvate uptake directs glutamine into the TCA cycle away from glutathione synthesis and impairs hepatocellular tumorigenesis. Cell Rep. 2019;28(2608–2619):e2606. https://doi.org/10.1016/j.celrep.2019.07.098 .

Article   CAS   Google Scholar  

Tsai KYF, Tullis B, Mejia J, et al. Regulation of trophoblast cell invasion by Pyruvate Kinase isozyme M2 (PKM2). Placenta. 2021;103:24–32. https://doi.org/10.1016/j.placenta.2020.10.019 .

Varol E, Akcay S, Ersoy IH, et al. Aortic elasticity is impaired in patients with endemic fluorosis. Biol Trace Elem Res. 2010;133:121–7. https://doi.org/10.1007/s12011-009-8578-4 .

Wall VZ, Barnhart S, Kanter JE, et al. Smooth muscle glucose metabolism promotes monocyte recruitment and atherosclerosis in a mouse model of metabolic syndrome. JCI Insight. 2018. https://doi.org/10.1172/jci.insight.96544 .

Wojcik OP, Koenig KL, Zeleniuch-Jacquotte A, et al. The potential protective effects of taurine on coronary heart disease. Atherosclerosis. 2010;208:19–25. https://doi.org/10.1016/j.atherosclerosis.2009.06.002 .

Wu M, Liu W, Huang H, et al. PVT1/miR-145-5p/HK2 modulates vascular smooth muscle cells phenotype switch via glycolysis: the new perspective on the spiral artery remodeling. Placenta. 2022;130:25–33. https://doi.org/10.1016/j.placenta.2022.10.010 .

Wu Y, Zhou J, Wang H, et al. The activation of p38 MAPK limits the abnormal proliferation of vascular smooth muscle cells induced by high sodium concentrations. Int J Mol Med. 2016;37:74–82. https://doi.org/10.3892/ijmm.2015.2394 .

Yang M, Li H, Rong M, et al. Dysregulated GLUT1 may be involved in the pathogenesis of preeclampsia by impairing decidualization. Mol Cell Endocrinol. 2022;540:111509. https://doi.org/10.1016/j.mce.2021.111509 .

Yue B, Zhang X, Li W, et al. Fluoride exposure altered metabolomic profile in rat serum. Chemosphere. 2020;258:127387. https://doi.org/10.1016/j.chemosphere.2020.127387 .

Zhang C, Wang Y, Huang F, et al. Fluoride induced metabolic disorder of endothelial cells. Toxicology. 2023;492:153530. https://doi.org/10.1016/j.tox.2023.153530 .

Zhao S, Guo J, Xue H, et al. Systematic impacts of fluoride exposure on the metabolomics of rats. Ecotoxicol Environ Saf. 2022;242:113888. https://doi.org/10.1016/j.ecoenv.2022.113888 .

Zhou Q, Xu J, Liu M, et al. Warburg effect is involved in apelin-13-induced human aortic vascular smooth muscle cells proliferation. J Cell Physiol. 2019;234:14413–21. https://doi.org/10.1002/jcp.28218 .

Download references

Acknowledgements

Not applicable.

This work was supported by STU Scientific Research Initiation Grant, SRIG (NTF22027, NTF22028); the National Nature Science Foundation of China (Grant Number 81803174, 82273751).

Author information

Yan-Shu Li, Ru-Ru Yang, Xin-Ying Li, and Wei-Wei Liu have contributed equally to this study.

Authors and Affiliations

School of Public Health, Shantou University, 243 Daxue Road, Jinping District, Shantou, 515063, Guangdong Province, China

Yan-Shu Li, Xin-Ying Li, Yi-Hong Gao, Min-Qi Huo & Bing-Yun Li

Center for Endemic Disease Control, Chinese Center for Disease Control and Prevention, Key Lab of Etiology and Epidemiology, Harbin Medical University, Education Bureau of Heilongjiang Province & Ministry of Health (23618504), Harbin, 150081, China

Ru-Ru Yang, Ming-Man Zu & Yu-Ting Jiang

Weihai Municipal Hospital, Weihai, 264299, Shandong Province, China

Wei-Wei Liu

Xinyi Center for Disease Control and Prevention, Xinyi, China

Yi-Ming Zhao

You can also search for this author in PubMed   Google Scholar

Contributions

Yan-Shu Li, Ru–Ru Yang, Xin-Ying Li, Weiwei Liu: Writing, review and editing, Project administration, Formal analysis. Yi-Ming Zhao, Ming-Man Zu: Project administration. Yi-Hong Gao, Min-Qi Huo: Data curation. Yu-Ting Jiang: Conceptualization. Bing-Yun Li: Conceptualization, Writing, review and editing, Supervision and Funding acquisition. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Bing-Yun Li .

Ethics declarations

Ethics approval and consent to participate.

All animal procedures were approved by the Animal Care and Use Committee of Harbin Medical University, Harbin, China (NO. hrbmuecdc20230501).

Consent for publication

Competing interests.

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Additional information

Publisher's note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article.

Li, YS., Yang, RR., Li, XY. et al. Fluoride impairs vascular smooth muscle A7R5 cell lines via disrupting amino acids metabolism. J Transl Med 22 , 528 (2024). https://doi.org/10.1186/s12967-024-05350-0

Download citation

Received : 13 March 2024

Accepted : 26 May 2024

Published : 01 June 2024

DOI : https://doi.org/10.1186/s12967-024-05350-0

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Cardiovascular
• Metabolomics
• Amino acids metabolism

Journal of Translational Medicine

ISSN: 1479-5876

• Submission enquiries: Access here and click Contact Us
• General enquiries: [email protected]

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• J Dent (Shiraz)
• v.16(3 Suppl); 2015 Sep

The Effectiveness of Home Water Purification Systems on the Amount of Fluoride in Drinking Water

Behrooz eftekhar.

a Dept. of Endodontic, School of Dentistry, Ahwaz Jondishapoor University of Medical Sciences, Ahwaz, Iran.

Masoume Skini

b Postgraduate Student, Dept. of Endodontic, School of Dentistry, Ahwaz Jondishapoor University of Medical Sciences, Ahwaz, Iran.

Milad Shamohammadi

Jaber ghaffaripour.

c DDS, School of Dentistry, Ahwaz Jondishapoor University of Medical Sciences, Ahwaz, Iran.

Firoozeh Nilchian

d Dental Students Research Center, Dept. of Dental Public Health, School of Dentistry, Isfahan University of Medical Sciences, Isfahan, Iran.

Statement of the Problem

Water purification systems for domestic use have drawn significant attention over the past few years. This can be related to the improvement of public health and concern for water contamination. 

The aim of this study was to evaluate whether home water purification systems eliminate the essential materials such as fluoride besides filtrating the heavy ions and other unwanted particles out of water.

Materials and Method

In this experimental study, six most frequently used commercial brands of water purifiers were evaluated and compared. Specimens were collected right before and after setting up the device, and 6 months later. Then, spectrophotometry (the Harrison device) was performed to compare fluoride clearance by each home water cleaner device.

Based on the data collected from all water purification devices in different locations, the amount of fluoride was significantly different before and right after using home water purifier and six months later ( p = 0.001 and p = 0.00, respectively).

The filtration of water significantly decreased its fluoride concentration. The fluoride content of purified water was approximately as much as zero in some cases.

Introduction

Fluoride is a natural element branched from Fluorine. This element can be found in all sorts of water and soil. Out of every kilogram of outer layer of earth, 0.3 gram is fluoride. Mineral waters have more amount of this element compared to other sources.( 1 )

About 60 years ago, Grand Rapids in Michigan State was the first city in which fluoride supplement was synthetically added to tap water. In US, adding fluoride to community water supplies of many cities has improved the oral health of millions of American citizens.( 2 )

Fluoridation of community water supplies is adding a specific amount of fluoride (0.7-1.2 ppm) to water in order to reduce the risk of dental caries. By 2002, almost 170 million Americans were provided with this privilege.( 3 )

Since most of the systemic fluoride is provided through tap water to population, many policies have been established to add fluoride to community water regarding its benefits for teeth and bones.( 4 )

In regions and countries that do not have water-fluoridation technology, there are natural supplements as previously mentioned. For example, Iran has many mineral water supplies that contain considerable amounts of fluoride. Amount of fluoride in natural mineral waters depends on weather conditions; the warmer the weather is, the higher the amount of fluoride can be detected. Mineral waters in southern regions that have warmer weather contain more fluoride. In Iran, the highest amount of fluoride has been found in southeast and northeast areas.

Water purification systems for domestic use have drawn much of attention over the past few years. This can be related to improvement of public health and concerns for water contamination. There are several types of home water purification systems that can be categorized into 3 different groups( 5 ) as filtered systems, systems using UV irradiation, and ion-exchange systems.

The aim of this study was to find out whether domestic water purification systems could eliminate the essential materials such as fluoride besides filtrating the heavy ions and other unwanted particles out of water.

In this study, 6 frequently used commercial brands of water purifiers in Ahwaz were compared. The commercial brands evaluated in the current study were CCK (Ceramic and Ceramic/Carbon Cartridges ; RTX-TS DLM filters, Korea), Soft Water (Ceramic Candles; Alpine TJ Series filters, W9332420, USA), Alkusar (Special media cartridges filters; PRB50-IN, USA), Puricom (Special media cartridges filters; Watts 4.5" x 10" Dual Housing, Korea), Water Safe (Granular Carbon Cartridges filters; LCV (Lead, Cysts, VOC's) (Carbon Block Filter Cartridges, Australia), and Aquafresh (Sediment String-Wound; Poly Spun and Pleated Washable Cartridges filters, K5520, USA). The main drinking water supply for Ahwaz is provided by governmental companies. After making arrangement with certain companies that supported these brands, the devices were setup in 6 different regions of Ahwaz. Samples were collected before and right after setting up the device. To reduce the errors and elevate the accuracy of the module, 5 samples were taken from each device. Another sample was collected from each single device 6 months later. A total of 64 samples were collected including 32 unfiltered (control) and 32 filtered samples of tap water (experimental) from 6 regions in Ahwaz. Fluoride sampling kits (Spands; EW-99574-08Hach ® Test Kits, USA) were used to test the amount of fluoride in sample waters. Samples were all collected in polyethylene sampling containers and were then coded. Spectrophotometry (AvaSpec-ULS2048L- USB2 UARS spectrometer, USA) was performed. In order to measure the characteristics of individual molecules, a mass spectrometer converted them to ions so that they could be moved about and manipulated by external electric and magnetic fields.

Atmospheric pressure was around 760 torr (mm of mercury). The pressure under which ions may be handled is roughly 10 -5 to 10 -8 torr (less than a billionth of an atmosphere). By varying the strength of the magnetic field, ions of different mass can be focused progressively on a detector fixed at the end of a curved tube and also under a high vacuum.

Latin alphabetic words were used to code each commercial device. Numbers were used for samples obtained before and after setting the device.( 6 )

The results were analyzed by using paired sample t-test, with alpha (ɑ) set at 0.05.

The amount of fluoride in water before and after using six brands of water purifier device is summarized in Table 1 .

The amount of fluoride before and after installing water purifier devices

Based on the data gathered from all water purification devices set in different regions, the level of fluoride was significantly different before and after using home water purifier ( p = 0.001). It was found that home water purifiers nearly eliminated fluoride from tap water. Table 2 represents the results of t-test.

Comparison of different study groups with t-test

* p< 0.05 is statistically significant.

Another round of sampling was done 6 months later from the same filters of home water purifier. Details are illustrated in Table 3 and 4.

The amount of fluoride in tap water after 6 months of using a water purification filter

Comparison of the study groups after six mounts with t-test

Fluoride absorption is mostly systemic or local; systemic absorption occurs through eating the element with food, water or fluoride pills, and local absorption by toothpastes and other fluoride-containing hygienic products. In many countries, the highest supply for fluoride absorption is systemic absorption through water consumption.( 6 ) In early 20 th century, the first attempts were made to fluoridate public water supplies, which eventually led to 40% decrease of dental caries in the target population.( 7 )Introduction of water fluoridation in the 1950-1960 and fluoride-containing dental products in the 1970 changed the situation. The main sources of fluoride in established market economies (EME) are drinking water, fluoridated salt, foods and beverages, baby cereals and formulas, fluoride supplements, toothpastes, mouth-rinses, and topical fluorides. Additionally, fluoride in water has a diffusion or halo effect; which means that the drinks and foods manufactured in fluoridated areas are also available to whole population including the residents of non-fluoridated areas.

Although adding fluoride to almost all oral hygienic products has restricted the effect of fluoride water (Halo effect), it is still common to fluoridate the city water supply.( 6 ) In many areas of the world, there is no systematic plan for fluoridation of community water and only the natural sources supply it. Therefore, sometimes the hardness of water and aggregation of different and sometimes poisonous elements drive the population to use bottled water or use home purification devices.

The findings of the present study revealed that all the 6 devices reduced the fluoride in tap water and most of them nearly eliminated it. Different home purification devices have been marketed each of which is claimed to eliminate certain kinds of elements from water.( 9 ) JK Mwabi et al. (2011) used 4 different filters to reduce the hardness and chemical contamination of water in poor villages in Africa, and reported that all of the four filters reduced the fluoride significantly. Bucket filter had the most significant effect and reduced fluoride element 99.9%. These results also indicated that fluoride was the most reduced element of all. Likewise, silver-impregnated porous pot (SIPP) filter reduced 90%-100% of elements.

Clasen et al. ( 5 ) in their study reported that 3 different home purification systems ,the ceramic candle gravity filter, iodine resin gravity filter, and iodine resin faucet filter, reduced bacterial contamination by four logs and decreased ions such as fluoride and arsenic, as well.

Moreover, there are certain methods to reduce the excessive amount of fluoride in the water. One of the best-known methods is absorption technique.( 7 ) Evaluation of 6 different commercial water purifiers has not been done in any other study; therefore, there is no similar study to compare the results exactly. More evaluations are suggested to be performed on home water purification systems, and more strategies should be devised to preserve the essential elements of tap water.

The current study found considerable differences between the amount of fluoride before and after filtration with home purification device; that is filtration significantly decreased the fluoride concentration even as much as 100% in some cases.

Conflict of Interest: None declared

Could fluoride in pregnancy affect kids' development? A study suggests a link

N ew research suggests fluoride exposure during pregnancy could be linked to neurobehavioral issues in kids. But even the study’s authors — who were prompted to examine the issue based on previous concerns about prenatal fluoride — say it’s too soon to stop adding the cavity-fighting mineral to drinking water. 

The new study found that women who had higher levels of fluoride during pregnancy reported later that their kids were more likely to have temper tantrums, complain of vague headaches and stomachaches and show other neurobehavioral symptoms by age 3.

The study, the first of its kind in the U.S., comes as a growing number of cities are opting to ban fluoride in public water systems .

“I don’t think we’re at the point where we are saying that water should not be fluoridated. It’s generally considered one of the biggest public health wins, certainly for the dental community,” said study author Tracy Bastain, an associate professor of clinical population and public health sciences at the Keck School of Medicine of the University of Southern California.

“But our results do give me pause,” Bastain said. “Pregnant individuals should probably be drinking filtered water.”

The study, published Monday in JAMA Network Open , analyzed urine samples taken from 229 women during their third trimester of pregnancy. Study participants were predominantly Hispanic women living in Los Angeles and were part of ongoing research from USC’s MADRES Center for Environmental Health Disparities. The center works to understand how a variety of toxins and other environmental hazards affect low-income and other marginalized communities.

For the new study, researchers asked the moms to fill out a checklist to assess their children’s emotional and behavioral health at age 3.

Kids whose mothers had higher levels of fluoride in their urine were 83% more likely to exhibit a range of neurobehavioral issues, including anxiety, emotional reactivity and physical complaints, such as unexplained headaches and stomachaches, according to the forms the mothers had completed.

The forms also included questions about symptoms that may be associated with autism spectrum disorder, such as a tendency not to make eye contact.

While the kids whose moms had higher levels of fluoride had greater odds of showing behavioral symptoms, according to the study, Bastain strongly cautioned against interpreting the findings as anything more than a possible association.

“It certainly doesn’t mean that the child has autism. We don’t even have autism diagnosis information” for the children in the study, she said.

The National Institutes of Health and the Environmental Protection Agency funded the USC study.

Bastain said the research team wanted to look specifically at the potential effects of fluoride on childhood development because of concerns raised by other scientists.

A 2019 study published in JAMA Pediatrics , for example, found that IQ levels were slightly lower in 3- and 4-year-old children whose mothers had higher measures of fluoride in their urine when they were pregnant.

Dr. Mark Moss, division director of public health dentistry at the East Carolina University School of Dental Medicine in Greenville, North Carolina, expected the findings to “cause a stir” but urged caution.

“This is something that deserves a further look,” said Moss, who was not involved in the new study. “But in terms of public health practice, no, this doesn’t rise to the level of hitting the pause button” on fluoridation.

Neurobehavioral symptoms identified by the moms in the study did not necessarily meet the level of clinical diagnosis.

“To say that there was an increase in odds for something that is borderline subclinical, it’s hard to say that this now warrants a reconsideration of public health,” said Dr. Nathaniel DeNicola, an OB-GYN in private practice in Yorba Linda, California.

Still, DeNicola, who hosts a podcast  about possible effects of environmental toxins on pregnancy health, recommends that his pregnant patients use water filters to remove other potentially harmful chemicals, like pesticides. He was not involved in the new research.

One strength of the study, DeNicola said, is that the authors made an attempt to account for lead exposure, which is well known to cause neurodevelopmental problems in kids. But lead levels were only measured during the first trimester of pregnancy and didn’t correspond with the timing of the fluoride samples.

The study had several flaws.

The researchers couldn’t say whether the women in the study drank fluoridated water. The MADRES study may not apply to other populations or areas of the country. And researchers did not test fluoride levels in the kids themselves.

Experts not associated with the new study said that a single urine sample taken once during pregnancy is hardly a reliable indication of true fluoride exposure. Bastain acknowledged that samples taken over a 24-hour period would have been “a little more ideal.”

“If researchers truly want to study fluoride intakes and health effects, a robust study must be undertaken in areas of naturally fluoridated water from low concentrations and higher concentrations,” said Dr. Johnny Johnson, a pediatric dentist and president of the American Fluoridation Society. “Areas like this exist in the U.S. and can easily be done to investigate any health effects whatsoever.”

This article was originally published on NBCNews.com